PCT Patents in Blood Anticlot Technology, Medications and
Medical Devices Published in 2013
Clck to enlarge and view details

Thank you for visiting FormulaScan . Please click on the WO Patent No to study the full patent document

WIPO - WORLD PATENTS IN BLOOD ANTICLOT DRUGS AND DEVICES PUBLISHED IN 2013



Publication No.: WO2013001073A1  Published: 03/Jan/2013

Title: A NEW STABLE ANESTHETIC COMPOSITION FOR REDUCING SKIN REACTIONS

Applicant/Assignee: GALDERMA RESEARCH & DEVELOPMENT

Application No.: WO2012EP62731 (PCT/EP2012/62731)   Filing Date: 29/Jun/2012

Abstract:

A composition with reduced degradation rate and/or improved stability of its components and decreasing of alleviating or even annihilating cutaneous reactions comprising an emulsion with an oil phase and an aqueous phase, said oil phase being a eutectic mixture of at least one anesthetic compound and at least one adrenergic receptor agonist and method use.

Priority: US201161502480P Applic. Date: 2011-06-29; FR20110056041 Applic. Date: 2011-07-05

Inventor: PORTAL THIBAUD [FR]


Publication No.: WO2013003112A1  Published: 03/Jan/2013

Title: METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER AND AUTOIMMUNE DISEASE

Applicant/Assignee: THE JACKSON LABORATORY

Application No.: WO2012US43074 (PCT/US2012/43074)   Filing Date: 19/Jun/2012

Abstract:

The technology described herein relates to methods of inducing cell death. The technology described herein further relates to treating conditions including cancers and autoimmune diseases comprising administering inhibitors of double strand break repair. Also described herein are inhibitors of double strand break repair and methods of screening for such inhibitors.

Priority: US201161501522P Applic. Date: 2011-06-27

Inventor: MILLS KEVIN DAVID [US]; HASHAM MUNEER GULAMHUSIEN [US]; MCPHEE CAROLINE GARDNER [US]


Publication No.: WO2013003346A2  Published: 03/Jan/2013

Title: MICRORNA-31 COMPOSITIONS AND METHODS FOR USE IN AUTOIMMUNE DISEASE

Applicant/Assignee: MEDIMMUNE, LLC, SHANGHAI RENJI HOSPITAL

Application No.: WO2012US44197 (PCT/US2012/44197)   Filing Date: 26/Jun/2012

Abstract:

The present disclosure provides methods for treating systemic lupus erythematosus and other autoimmune conditions.

Priority: US201161501482P Applic. Date: 2011-06-27

Inventor: YAO YIHONG [US]; SHEN NAN [CN]; FAN WEI [CN]; TANG YUANJIA [CN]


Publication No.: WO2013003445A1  Published: 03/Jan/2013

Title: TETRA-PYRIDINE COMPOUNDS AND COMPOSITION FOR PROTECTING CELLS, TISSUES AND ORGANS AGAINST ISCHEMIA-REPERFUSION INJURY

Applicant/Assignee: ATHENA CARDIONET LTD, YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREWUNIVERSITY, LTD, GERAGHTY, ERIN

Application No.: WO2012US44376 (PCT/US2012/44376)   Filing Date: 27/Jun/2012

Abstract:

The invention provides a novel tetra-pyridine compound and a composition containing this compound for protecting and preserving cells, tissues and organs against ischemia-reperfusion injury. A method and use of the tetra-pyridine compound for preventing or treating ischemia-reperfusion injury or for protecting and preserving excorporeal tissue or organ from ischemia and oxygen radical-related damage are also provided.

Priority: US201161503151P Applic. Date: 2011-06-30

Inventor: APPELBAUM JERACHMIEL Y [IL]; TSHUVA GOLDBERG EDIT [IL]


Publication No.: WO2013003824A1  Published: 03/Jan/2013

Title: THERAPEUTIC AGENT PREPARATIONS FOR DELIVERY INTO A LUMEN OF THE INTESTINAL TRACT USING A SWALLOWABLE DRUG DELIVERY DEVICE

Applicant/Assignee: RANI THERAPEUTICS, LLC

Application No.: WO2012US45138 (PCT/US2012/45138)   Filing Date: 29/Jun/2012

Abstract:

Embodiments of the invention provide swallowable devices, preparations and methods for delivering drugs and other therapeutic agents within the GI tract. Many embodiments provide a swallowable device for delivering the agents. Particular embodiments provide a swallowable device such as a capsule for delivering drugs into the intestinal wall or other GI lumen. Embodiments also provide various drug preparations that are configured to be contained within the capsule, advanced from the capsule into the intestinal wall and degrade to release the drug into the bloodstream to produce a therapeutic effect. The preparation can be operably coupled to delivery means having a first configuration where the preparation is contained in the capsule and a second configuration where the preparation is advanced out of the capsule into the intestinal wall. Embodiments of the invention are particularly useful for the delivery of drugs which are poorly absorbed, tolerated and/or degraded within the GI tract.

Priority: US201161571652P Applic. Date: 2011-06-30; US201161571679P Applic. Date: 2011-06-29; US201161571648P Applic. Date: 2011-06-30; US201161571649P Applic. Date: 2011-06-30; US201161571633P Applic. Date: 2011-06-29; US201161571631P Applic. Date: 2011-06-30; US201161571619P Applic. Date: 2011-06-30; US201161571687P Applic. Date: 2011-06-29; US201161571641P Applic. Date: 2011-06-29; US201161571634P Applic. Date: 2011-06-29; US201161571686P Applic. Date: 2011-06-29; US201161571650P Applic. Date: 2011-06-30; US201161571642P Applic. Date: 2011-06-30; US201161571643P Applic. Date: 2011-06-29; US201161571632P Applic. Date: 2011-06-29

Inventor: IMRAN MIR [US]


Publication No.: WO2013006906A1  Published: 17/Jan/2013

Title: DERMATAN SULPHATE, PHARMACEUTICAL COMPOSITIONS AND PROCESS FOR PRODUCING SAME

Applicant/Assignee: COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION

Application No.: WO2012AU00828 (PCT/AU2012/00828)   Filing Date: 11/Jul/2012

Abstract:

There is provided methods for the enrichment, isolation and/or modification of the dermatan sulphate (DS) derived from sources including hide processing waste streams. There is also provided uses of dermatan sulphate and/or low molecular weight dermatan sulphate in the treatment of haematological disorders

preparation of medicaments

supplements

nutraceuticals

functional food ingredients and functional food.

Priority: AU20110902761 Applic. Date: 2011-07-11

Inventor: MASCI PAUL PANTALEONE [AU]; DE SILVA KIRTHI [AU]; OSBORNE SIMONE [AU]; SEYMOUR ROBERT BRUCE [AU]


Publication No.: WO2013007308A1  Published: 17/Jan/2013

Title: PLATELET-RICH PLASMA COMPOSITION FOR TISSUE REPAIR AND REGENERATION

Applicant/Assignee:

Application No.: WO2011EP62045 (PCT/EP2011/62045)   Filing Date: 14/Jul/2011

Abstract:

The present invention relates to platelet-rich plasma (PRP) for epicutaneous use in a wide range of applications in the cosmetic and dermatological fields and to a functional bioactive composition suitable for topical use, which comprises said PRP and allows complete absorption into the skin, hair or scalp, and which has a regenerating action for relaxing expression wrinkles, a lifting effect for sustaining relaxed skin tissues, for scar reduction and wound healing. The present composition performs a regenerating and a repairing action on the skin cell layers, combining the benefits of increasing vitality and longevity of the skin, scalp and hair follicle, without the disadvantages of invasive techniques. The present composition is formulated to allow complete absorption of the PRP and guarantees the vital function of platelet growth factors while combining a gradual, more physiological releasing rate, and stimulating the recruiting of stem cells.

Priority: WO2011EP62045 Applic. Date: 2011-07-14

Inventor: GARBIN STEFANIA [CH]


Publication No.: WO2013007762A1  Published: 17/Jan/2013

Title: COMBINATION OF AN ANTICOAGULANT AND AVIDIN USEFUL IN SURGICAL INTERVENTION AND CLINICAL PROCEDURE

Applicant/Assignee: ENDOTIS PHARMA

Application No.: WO2012EP63616 (PCT/EP2012/63616)   Filing Date: 11/Jul/2012

Abstract:

The present invention concerns products containing: compound (I) of formula or a salt -thereof

and avidin, as a combination product for the separate and successive administration in prevention of blood clotting disorders during and after a surgical intervention or a clinical procedure, wherein compound (I) or a salt -thereof is administered just before the surgical intervention or clinical procedure and avidin is administered after the surgical intervention or clinical procedure.

Priority: EP20110305904 Applic. Date: 2011-07-11

Inventor: NEUHART ERIC [FR]; PETITOU MAURICE [FR]


Publication No.: WO2013009527A2  Published: 17/Jan/2013

Title: FACTOR IXA INHIBITORS

Applicant/Assignee: MERCK SHARP & DOHME CORP

Application No.: WO2012US45348 (PCT/US2012/45348)   Filing Date: 03/Jul/2012

Abstract:

The present invention provides a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof. The present invention also provides pharmaceutical compositions comprising one or more said compounds, and methods for using said compounds for treating or preventing a thromboses, embolisms, hypercoagulability or fibrotic changes.

Priority: US201161505647P Applic. Date: 2011-07-08

Inventor: BOYLE CRAIG D [US]; GREENLEE WILLIAM [US]; CHACKALAMANNIL SAMUEL [US]; LANKIN CLAIRE [US]


Publication No.: WO2013009755A2  Published: 17/Jan/2013

Title: METHOD OF USE OF ACTIVATED FUNCTIONAL PROTEINS TO IMPROVE ANIMAL HEALTH

Applicant/Assignee: PURETEIN BIOSCIENCE, LLC

Application No.: WO2012US46079 (PCT/US2012/46079)   Filing Date: 10/Jul/2012

Abstract:

It was found that feeding a composition including activated growth factor(s) increases feed to gain ratio, increases overall weight gain, reduces necessary antibiotic or electrolyte therapy and reduces mortality in animals. The composition is derived by first separating growth factor (s) from a source such as whey or blood, then subjecting the factor to an activation process, and then providing the activated growth factor to the animal. A feed additive comprising activated growth factors in appropriate amounts, shows results that are an improvement over standard therapies of supplementation. Application of activated growth factors may be by topical, injection or oral application.

Priority: US201113182018 Applic. Date: 2011-07-13

Inventor: STROHBEHN RONALD E [US]


Publication No.: WO2013010032A1  Published: 17/Jan/2013

Title: GEL COMPOSITIONS OF OXYMETAZOLINE AND METHODS OF USE

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US46547 (PCT/US2012/46547)   Filing Date: 12/Jul/2012

Abstract:

Embodiments relating to gels comprising imidazoline alpha agonists, such as, without limitation, oxymetazoline or a pharmaceutically acceptable salt thereof, and methods for treating diseases, such as, without limitation, rosacea, including, for example, erythematotelangiectatic rosacea, papulopustular rosacea, phymatous rosacea, ocular rosacea or combinations thereof

and symptoms associated with rosacea, including, for example, papules, pustules, phymas (skin thickening), telangiectasias or erythema or redness associated with rosacea, other skin erythemas, telangiectasias, purpura or the like, and other manifestations associated therewith or combinations thereof using such gels are described herein.

Priority: US201161507926P Applic. Date: 2011-07-14

Inventor: SHANLER STUART D [US]; POWALA CHRISTOPHER [US]; BROWN MARC BARRY [GB]; LIM SIAN TIONG [GB]; GREENAWAY EVANS CHARLES RODNEY [GB]


Publication No.: WO2013010260A1  Published: 24/Jan/2013

Title: ISOLATED BRACHYSPIRA AND METHODS AND COMPOSITIONS FOR EXPANDING AND ISOLATING BRACHYSPIRA

Applicant/Assignee: UNIVERSITY OF SASKATCHEWAN

Application No.: WO2012CA00682 (PCT/CA2012/00682)   Filing Date: 18/Jul/2012

Abstract:

The disclosure provides isolated-, compositions comprising - and methods of culturing - a Brachyspira sp. Sask30446 organism. The method comprises inoculating a liquid media or solid media with a sample comprising the Brachyspira sp. Sask30446 organism and incubating the liquid media or solid media at a temperature between 25-44oC under anaerobic conditions. Also provided is isolated Brachyspira sp. Sask30446 organism, compositions comprising Brachyspira sp. Sask30446 organism and methods and uses thereof.

Priority: WO2011CA00828 Applic. Date: 2011-07-18; US201161554281P Applic. Date: 2011-11-01; US201161568390P Applic. Date: 2011-12-08; US201261657757P Applic. Date: 2012-06-09

Inventor: HARDING JOHN CLARE SAMUEL [CA]; HILL JANET ELIZABETH [CA]; RUBIN JOSEPH [CA]; CHIRINO MANUEL [CA]


Publication No.: WO2013011536A1  Published: 24/Jan/2013

Title: INTRANASAL ADMINISTRATION OF AGENTS WITH PRO-INFLAMMATORY ACTIVITY FOR THE THERAPY OF NEUROLOGICAL DISORDERS

Applicant/Assignee:

Application No.: WO2012IT00227 (PCT/IT2012/00227)   Filing Date: 20/Jul/2012

Abstract:

The invention concerns a product consisting of distilled water or of an aqueous solution hypotonic or substantially isotonic with respect to blood plasma or, less preferably, hypertonic with respect to blood plasma, to be administered on the nasal mucosa according to a specific operation mode in order to cause an inflammation of an irritative kind, for use in a treatment of stimulation of the endogenous production of inflammatory mediators, in the therapy and prevention of neurological disorders, in particular of degenerative disorders of the central and peripheral nervous system. The inflammatory mediators the endogenous production of which is stimulated comprise NGF, neurotrophin-3, neurotrophin-4, serotonin, substance P, heparin, ECF-A.

Priority: IT2011RM00390 Applic. Date: 2011-07-21

Inventor: SALVINELLI FABRIZIO [IT]; SALVINELLI BEATRICE [IT]; SALVINELLI EMANUELE [IT]; D ERAMO ALESSANDRA [IT]


Publication No.: WO2013012924A2  Published: 24/Jan/2013

Title: ENGINEERED MICROBE-TARGETING MOLECULES AND USES THEREOF

Applicant/Assignee: PRESIDENT AND FELLOWS OF HARVARD COLLEGE, WATTERS, ALEXANDER

Application No.: WO2012US47201 (PCT/US2012/47201)   Filing Date: 18/Jul/2012

Abstract:

Described herein are engineered microbe-targeting or microbe-binding molecules, kits comprising the same and uses thereof. Some particular embodiments of the microbe-targeting or microbe-binding molecules comprise a carbohydrate recognition domain of mannose-binding lectin, or a fragment thereof, linked to a portion of a Fc region. In some embodiments, the microbe-targeting molecules or microbe-binding molecules can be conjugated to a substrate, e.g., a magnetic microbead, forming a microbe-targeting substrate (e.g., a microbe-targeting magnetic microbead). Such microbe-targeting molecules and/or substrates and the kits comprising the same can bind and/or capture of a microbe and/or microbial matter thereof, and can thus be used in various applications, e.g., diagnosis and/or treatment of an infection caused by microbes such as sepsis in a subject or any environmental surface.

Microbe-targeting molecules and/or substrates can be regenerated after use by washing with a low pH buffer or buffer in which calcium is insoluble.

Priority: US201161508957P Applic. Date: 2011-07-18; US201261605052P Applic. Date: 2012-02-29; US201261605081P Applic. Date: 2012-02-29

Inventor: INGBER DONALD E [US]; SUPER MICHAEL [US]; WAY JEFFREY CHARLES [US]; CARTWRIGHT MARK J [US]; BERTHET JULIA B [US]; SUPER DINAH R [US]; ROTTMAN MARTIN M [US]


Publication No.: WO2013012945A1  Published: 24/Jan/2013

Title: METHODS OF TREATING CARDIOVASCULAR DISEASES AND PREDICTING THE EFFICACY OF EXERCISE THERAPY

Applicant/Assignee: CRITICAL CARE DIAGNOSTICS, INC

Application No.: WO2012US47238 (PCT/US2012/47238)   Filing Date: 18/Jul/2012

Abstract:

Methods of treating a subject having a cardiovascular disease, selecting a therapy for a subject having a cardiovascular disease, identifying a subject having a cardiovascular disease that will benefit or not benefit from exercise therapy, determining whether a subject having a cardiovascular disease should begin, continue, not begin, discontinue, or avoid exercise therapy, determining whether a subject having a cardiovascular disease should continue, discontinue, or avoid exercise therapy, reducing the risk of an adverse outcome (e.g., death) in a subject having a cardiovascular disease, and predicting the efficacy of exercise therapy in a subject having a cardiovascular disease. These methods include determining a level of soluble ST2 in a subject.

Priority: US201161508923P Applic. Date: 2011-07-18; US201161509359P Applic. Date: 2011-07-19

Inventor: SNIDER JAMES V [US]; GERWIEN ROBERT W [US]


Publication No.: WO2013012954A2  Published: 24/Jan/2013

Title: RESORPTION ENHANCERS AS ADDITIVES TO IMPROVE THE ORAL FORMULATION OF NON-ANTICOAGULANT SULFATED POLYSACCHARIDES

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTHCARE S.A

Application No.: WO2012US47248 (PCT/US2012/47248)   Filing Date: 18/Jul/2012

Abstract:

Aspects of the invention include methods for enhancing blood coagulation in a subject. In practicing methods according to certain embodiments, an amount of a non-anticoagulant sulfated polysaccharide (NASP) in combination with a gastrointestinal epithelial barrier permeation enhancer is orally administered to a subject in a manner sufficient to enhance blood coagulation in the subject. Compositions and kits for practicing methods of the invention are also described.

Priority: US201161509514P Applic. Date: 2011-07-19

Inventor: TURECEK PETER [AT]; VEJDA SUSANNE [AT]


Publication No.: WO2013013799A1  Published: 31/Jan/2013

Title: WOUND SPRAY

Applicant/Assignee: SASTOMED GMBH

Application No.: WO2012EP03086 (PCT/EP2012/03086)   Filing Date: 23/Jul/2012

Abstract:

The present invention refers to a composition, comprising hemoglobin or myoglobin, wherein in at least 40% of said hemoglobin or myoglobin the oxygen binding site is charged by a non-02 ligand, and at least one further ingredient, a method for preparing said composition and the use of hemoglobin or myoglobin charged with a non-oxygen ligand for external treatment of wounds.

Priority: EP20110006057 Applic. Date: 2011-07-23

Inventor: SANDER MICHAEL [DE]


Publication No.: WO2013016634A1  Published: 31/Jan/2013

Title: USE OF IL-12 TO GENERATE ENDOGENOUS ERYTHROPOIETIN

Applicant/Assignee: NEUMEDICINES, INC

Application No.: WO2012US48540 (PCT/US2012/48540)   Filing Date: 27/Jul/2012

Abstract:

The present invention relates to the use of exogenous interleukin-12 (IL-12) for increasing endogenous production of erythropoietin.

Priority: US201161512344P Applic. Date: 2011-07-27

Inventor: BASILE LENA A [US]


Publication No.: WO2013018031A1  Published: 07/Feb/2013

Title: PHARMACEUTICAL COMPOSITIONS FOR GASTROINTESTINAL DRUG DELIVERY

Applicant/Assignee: LUPIN LIMITED

Application No.: WO2012IB53906 (PCT/IB2012/53906)   Filing Date: 31/Jul/2012

Abstract:

The present invention relates to controlled release pharmaceutical formulations of active principle(s) like tetracycline-class antibiotics for providing increased residence time in the gastrointestinal tract and the process of preparing them.

Priority: US201113195526 Applic. Date: 2011-08-01

Inventor: DESHMUKH ASHISH ASHOKRAO [IN]; BHUTADA PRAVIN MEGHRAJJI [IN]; CHANDRAN SAJEEV [IN]; KUMAR THOMMANDRU VIJAYA [IN]; KULKARNI SHIRISHKUMAR [IN]; DESHPANDAY NINAD [IN]


Publication No.: WO2013020600A1  Published: 14/Feb/2013

Title: PHARMACEUTICAL COMPOSITION COMPRISING A DRUG CONTAINING AT LEAST ONE TOXICOPHORE FUNCTION AND N-ACETYL-L-CYSTEINE

Applicant/Assignee: CROSS SA, EURODRUG LABORATORIES B.V

Application No.: WO2011EP63829 (PCT/EP2011/63829)   Filing Date: 11/Aug/2011

Abstract:

The present invention relates to a pharmaceutical composition containing at least one drug containing at least a toxicophore function, N-acetyl-L-cysteine (NAC), at least one antioxidant agent and at least one pharmaceutically acceptable excipient, and the same for use in the prevention and/or reduction of the occurrence of idiosyncratic adverse drug reactions ( IADRs ) caused by said drug.

Priority: WO2011EP63829 Applic. Date: 2011-08-11

Inventor: ASSANDRI ALESSANDRO [CH]; VAN GULIK FREDERICK [NL]


Publication No.: WO2013020724A1  Published: 14/Feb/2013

Title: COMPOSITION COMPRISING A TLR AGONIST AND AN ANTIBODY SPECIFIC FOR AN ANTIGEN AND USES THEREOF AS VACCINE

Applicant/Assignee: GLAXOSMITHKLINE BIOLOGICALS S.A

Application No.: WO2012EP57963 (PCT/EP2012/57963)   Filing Date: 01/May/2012

Abstract:

The invention provides a TLR agonist and an antibody which binds to an antigen such as a ss-amyloid antigen for use in stimulating an immune response to the antigen in an individual. The TLR agonist can be delivered at the same time as the antibody, less than 48 hours before the antibody or after the antibody. The compositions and methods provided are useful for prevention or treatment of Alzheimer's disease.

Priority: GB20110013570 Applic. Date: 2011-08-05

Inventor: LAROCQUE DANIEL [CA]; PALMANTIER REMI [BE]; TRIBOUT-JOVER PASCALE [CA]


Publication No.: WO2013022447A1  Published: 14/Feb/2013

Title: TREATMENT OF PERIPHERAL VASCULAR DISEASE USING UMBILICAL CORD TISSUE-DERIVED CELLS

Applicant/Assignee: ADVANCED TECHNOLOGIES AND REGENERATIVE MEDICINE, LLC

Application No.: WO2011US47264 (PCT/US2011/47264)   Filing Date: 10/Aug/2011

Abstract:

Compositions and methods of using cells derived from umbilical cord tissue, to stimulate and support angiogenesis, to improve blood flow, to regenerate, repair, and improve skeletal muscle damaged by a peripheral ischemic event, and to protect skeletal muscle from ischemic damage in peripheral vascular disease patients are disclosed. In particular, methods of treating a patient having a peripheral vascular disease with umbilical derived cells and fibrin glue are disclosed.

Priority: WO2011US47264 Applic. Date: 2011-08-10

Inventor: BUENSUCESO CHARITO S [US]; KIHM ANTHONY J [US]; DHANARAJ SRIDEVI [US]; ATLAS ROEE [IL]; NUR ISRAEL [IL]; MEIDLER ROBERTO [IL]; BAR LILIANA [IL]


Publication No.: WO2013022814A1  Published: 14/Feb/2013

Title: CYCLIC P1 LINKERS AS FACTOR XIA INHIBITORS

Applicant/Assignee: BRISTOL-MYERS SQUIBB COMPANY

Application No.: WO2012US49698 (PCT/US2012/49698)   Filing Date: 06/Aug/2012

Abstract:

The present invention provides compounds of Formula (Ia): or stereoisomers, tautomers, or pharmaceutically acceptable salts thereof, wherein all the variables are as defined herein. These compounds are selective factor XIa inhibitors or dual inhibitors of FXIa and plasma kallikrein. This invention also relates to pharmaceutical compositions comprising these compounds and methods of treating thromboembolic and/or inflammatory disorders using the same.

Priority: US201161515404P Applic. Date: 2011-08-05

Inventor: LAM PATRICK Y S [US]; CLARK CHARLES G [US]; CORTE JAMES R [US]; EWING WILLIAM R [US]; GILLIGAN PAUL J [US]; JEON YOON [US]; YANG WU [US]; SMITH LEON M II [US]; WANG YUFENG [US]


Publication No.: WO2013022818A1  Published: 14/Feb/2013

Title: NOVEL MACROCYCLES AS FACTOR XIA INHIBITORS

Applicant/Assignee: BRISTOL-MYERS SQUIBB COMPANY

Application No.: WO2012US49706 (PCT/US2012/49706)   Filing Date: 06/Aug/2012

Abstract:

The present invention provides compounds of Formula (Ia): or a stereoisomer, a tautomer, or a pharmaceutically acceptable salt thereof, wherein all the variables are as defined herein. These compounds are selective factor XIa inhibitors or dual inhibitors of FXIa and plasma kallikrein. This invention also relates to pharmaceutical compositions comprising these compounds and methods of treating thromboembolic and/or inflammatory disorders using the same.

Priority: US201161515401P Applic. Date: 2011-08-05

Inventor: PINTO DONALD J [US]; CORTE JAMES R [US]; GILLIGAN PAUL J [US]; FANG TIANAN [US]; SMITH II LEON M [US]; WANG YUFENG [US]; YANG WU [US]; EWING WILLIAM R [US]


Publication No.: WO2013024051A1  Published: 21/Feb/2013

Title: SUSTAINED RELEASE COMPOSITION OF PROSTACYCLIN

Applicant/Assignee: ASCENDIS PHARMA A/S

Application No.: WO2012EP65742 (PCT/EP2012/65742)   Filing Date: 10/Aug/2012

Abstract:

The present invention relates to sustained release compositions of prostacyclin, as well as uses thereof, in particular for the prevention and/or treatment of pulmonary arterial hypertension.

Priority: EP20110177411 Applic. Date: 2011-08-12; EP20110178075 Applic. Date: 2011-08-19; EP20120165512 Applic. Date: 2012-04-25

Inventor: SPROGOEE KENNETT [US]; RAU HARALD [DE]; HERSEL ULRICH [DE]; WEGGE THOMAS [DE]


Publication No.: WO2013033561A1  Published: 07/Mar/2013

Title: VEGF-SPECIFIC CAPTURE AGENTS, COMPOSITIONS AND METHODS OF USING AND MAKING

Applicant/Assignee: INTEGRATED DIAGNOSTICS, INC

Application No.: WO2012US53388 (PCT/US2012/53388)   Filing Date: 31/Aug/2012

Abstract:

The present application provides biligand and triligand protein-catalyzed capture (PCC) agents that specifically bind VEGF, as well as the use of these capture agents as detection, diagnosis, and treatment agents.

Priority: US201161529872P Applic. Date: 2011-08-31; US201261585590P Applic. Date: 2012-01-11; US201161556713P Applic. Date: 2011-11-07; US201261675298P Applic. Date: 2012-07-24

Inventor: PITRAM SURESH MARK [US]; AGNEW HEATHER DAWN [US]; LAI TSUN YIN [US]; ROHDE ROSEMARY DYANE [US]; KEARNEY PAUL EDWARD [CA]


Publication No.: WO2013035053A2  Published: 14/Mar/2013

Title: NOVEL CONJUGATION-FACILITATED TRANSPORT OF DRUGS ACROSS BLOOD BRAIN BARRIER

Applicant/Assignee: KAREUS THERAPEUTICS, SA

Application No.: WO2012IB54593 (PCT/IB2012/54593)   Filing Date: 06/Sep/2012

Abstract:

The present invention provides a conjugated therapeutic agent of formula I that can facilitate transport of therapeutic agent across the blood brain barrier thereby providing drug levels in brain to impart beneficial therapeutic effect.

Priority: IN2011MU02536 Applic. Date: 2011-09-09; US201161564618P Applic. Date: 2011-11-29

Inventor: SAXENA UDAY [US]; AKELLA VENKATESWARLU [IN]


Publication No.: WO2013036293A1  Published: 14/Mar/2013

Title: DENDRITIC CELL SUBSETS FOR GENERATING INDUCED TOLEROGENIC DENDRITIC CELLS AND RELATED COMPOSITIONS AND METHODS

Applicant/Assignee: SELECTA BIOSCIENCES, INC

Application No.: WO2012US35336 (PCT/US2012/35336)   Filing Date: 27/Apr/2012

Abstract:

Disclosed are induced tolerogenic dendritic cells (itDCs) produced from dendritic cell subsets that possess a desired physiological characteristic, as well as related compositions and methods.

Priority: US201161531121P Applic. Date: 2011-09-06; US201161531112P Applic. Date: 2011-09-06; US201161531131P Applic. Date: 2011-09-06; US201161531124P Applic. Date: 2011-09-06; US201161531140P Applic. Date: 2011-09-06; US201161531106P Applic. Date: 2011-09-06; US201161531127P Applic. Date: 2011-09-06; US201161531115P Applic. Date: 2011-09-06; US201161531231P Applic. Date: 2011-09-06; US201161531109P Applic. Date: 2011-09-06; US201161531103P Applic. Date: 2011-09-06

Inventor: KISHIMOTO TAKASHI KEI [US]; MALDONADO ROBERTO A [US]


Publication No.: WO2013036902A1  Published: 14/Mar/2013

Title: SUBMICRON PARTICLES TO DECREASE TRANSFUSION

Applicant/Assignee:

Application No.: WO2012US54378 (PCT/US2012/54378)   Filing Date: 10/Sep/2012

Abstract:

A submicron protein sphere and method to intravenously treat a patient requiring blood component transfusion. The submicron protein spheres have a size ranging from 1.0 micron to less than 0.1 micron and a molecular weight ranging from 780 billion Daltons to less than 0.8 billion Daltons. The protein spheres have no biologically active molecules added or bound to the protein spheres prior to administering to the patient. The protein used to construct the spheres can be human serum albumin from natural sources or recombinant DNA-derived serum albumin, or other proteins such as gelatin or synthetic polypeptides. However, the protein spheres can bind the various clotting factors including fibrinogen after the spheres have entered the blood stream, binding the necessary additional biologically active molecules supplied in vivo from the patient's own blood, and possibly in vitro.

Priority: US201161573630P Applic. Date: 2011-09-10; US201161627623P Applic. Date: 2011-10-14

Inventor: YEN RICHARD C K [US]


Publication No.: WO2013038395A1  Published: 21/Mar/2013

Title: TRANSITION METAL COMPLEXES FOR PHARMACEUTICAL APPLICATIONS

Applicant/Assignee: UNIVERSIDADE DE LISBOA

Application No.: WO2012IB54914 (PCT/IB2012/54914)   Filing Date: 17/Sep/2012

Abstract:

The family of ruthenium compounds that is subject of the present patent was found to exhibit great potential as pharmaceutical agents for the treatment of cancer condition. In fact, the present compounds which structure is based on piano stool Mu(eta5- ciclopentadienyl ) (M=Ru, Fe) possessing compulsory sigma bonded heteroaromatic ligands to treat tumor and /or metastasis. These compounds displayed very high efficiency in vitro in what concerns their cytotoxicity against a wide range of tumor cells significantly surpassing the activity of the benchmark metallodrug cisplatin currently in clinical use. In addition, we have identified biological targets involved in th mode of action of the ruthenium compounds such as, PARP-1 (a Poly- (adenosine diphosphate (ADP) -ribose) polymerase enzyme) and cell regulatory proteins (cytochrome C and ubiquitin). Although DNA is not the main target of the ruthenium compounds, their interaction with DNA was proved by different approaches. These agents bind to albumin which can provide a vehicle for their transport in the blood stream without loss of activity. Overall this family of compounds encloses a panel of highly promising new anti-tumor ruthenium agents with a large spectrum of activity.

Priority: PT20110105890 Applic. Date: 2011-09-16

Inventor: ANSELMO VIEGAS GARCIA MARIA HELENA [PT]; FERREIRA MORAIS TANIA SOFIA [PT]; ANTUNES TOMAZ DINIZ ANA ISABEL [PT]; MARUJO MARQUES FERNANDA [PT]; FERNANDES MENDES FILIPA [PT]


Publication No.: WO2013040164A1  Published: 21/Mar/2013

Title: COMPOSITIONS AND METHODS FOR TREATING METABOLIC DISORDERS

Applicant/Assignee: BIOMED VALLEY DISCOVERIES, INC

Application No.: WO2012US55088 (PCT/US2012/55088)   Filing Date: 13/Sep/2012

Abstract:

The present invention provides, inter alia, compositions containing enantiomerically pure (R)(+)-amisulpride or enantiomerically pure (R)(+)-sulpiride, optionally with dopamine receptor modulators. The present invention also provides compositions containing racemic (RS)-amisulpride or (RS)-sulpiride in combination with dopamine receptor modulators. Methods for preventing, treating, or ameliorating the effects of a metabolic disorder or key element thereof, for modulating blood glucose levels, and for preventing, treating, or ameliorating the effects of diabetes in a subject are also provided. Additionally, the present invention provides methods for counter-acting the dopamine antagonist activity of (S)-amisulpride in racemic (RS)-amisulpride, or the dopamine antagonist activity of (S)-sulpiride in racemic (RS)-sulpiride, administered to a subject to prevent, treat, or ameliorate the effects of a metabolic disorder.

Priority: US201161533934P Applic. Date: 2011-09-13

Inventor: HALSE REZA [US]; ROIX JEFFREY JAMES [US]; SAHA SAURABH [US]


Publication No.: WO2013040574A1  Published: 21/Mar/2013

Title: PTEROSTILBENE AND STATIN COMBINATION FOR TREATMENT OF METABOLIC DISEASE, CARDIOVASCULAR DISEASE, AND INFLAMMATION

Applicant/Assignee: CHROMADEX INC

Application No.: WO2012US55784 (PCT/US2012/55784)   Filing Date: 17/Sep/2012

Abstract:

A pharmaceutical composition is provided comprising a therapeutically effective amount of pterostilbene, a therapeutically effective amount of a statin compound, and a pharmaceutically acceptable carrier. The embodiments of the pharmaceutical compositions can have lipid lowering properties, or alternatively can have properties that can treat oxidative stress, by decreasing inflammation or inflammatory processes contributing to neurodegenerative diseases. A method of lowering lipid levels in an individual is also provided, comprising administering to the individual in need of such treatment a pharmaceutical composition including a therapeutically effective amount of pterostilbene, a therapeutically effective amount of a statin compound, and a pharmaceutically acceptable carrier, wherein lipid levels are decreased.

Priority: US201161535143P Applic. Date: 2011-09-15; US201213616567 Applic. Date: 2012-09-14

Inventor: BARTOS JEREMY [US]


Publication No.: WO2013043236A1  Published: 28/Mar/2013

Title: COMPOSITIONS AND METHODS USEFUL FOR REALTIME IN SITU PHYSIOLOGICAL MOLECULAR IMAGING OF OXYGEN METABOLISM

Applicant/Assignee: ROCKLAND TECHNIMED, LTD

Application No.: WO2012US36604 (PCT/US2012/36604)   Filing Date: 04/May/2012

Abstract:

Provided are compositions containing an emulsion containing a perfluorinated compound, as well as methods for preparation of the compositions. Also provided are formulations containing a complex of oxygen- 17 and the emulsion. Additionally provided are methods for the preparation of the formulations as well as kits containing the formulations. Further provided are methods of use of the formulations in imaging of tissues using a magnetic resonance imaging system.

Priority: US201161537823P Applic. Date: 2011-09-22

Inventor: GUPTE PRADEEP M [US]; DE LAPAZ ROBERT LOUIS [US]; RAVICHANDRAN RAMANATHAN [US]


Publication No.: WO2013044186A1  Published: 28/Mar/2013

Title: COMPOSITIONS AND METHODS FOR MOLECULAR IMAGING OF OXYGEN METABOLISM

Applicant/Assignee: ROCKLAND TECHNIMED, LTD

Application No.: WO2012US56775 (PCT/US2012/56775)   Filing Date: 22/Sep/2012

Abstract:

Provided are compositions containing an emulsion containing a perfluorinated compound, as well as methods for preparation of the compositions. Also provided are formulations containing a complex of oxygen- 17 and the emulsion compositions. Additionally provided are methods for the preparation of the formulations as well as kits containing the formulations. Further provided are methods of use of the formulations in imaging of tissues using a magnetic resonance imaging system.

Priority: US201161537823P Applic. Date: 2011-09-22; WO2012US36604 Applic. Date: 2012-05-04

Inventor: GUPTE PRADEEP M [US]; DE LAPAZ ROBERT LOUIS [US]; RAVICHANDRAN RAMANATHAN [US]


Publication No.: WO2013045885A1  Published: 04/Apr/2013

Title: TREATMENT FOR MITROCHONDRIAL NEUROGASTROINTESTINAL ENCEPHALOMYOPATHY (MNGIE)

Applicant/Assignee: ST GEORGE'S HOSPITAL MEDICAL SCHOOL

Application No.: WO2012GB52157 (PCT/GB2012/52157)   Filing Date: 03/Sep/2012

Abstract:

The invention provides a method of treating mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) in a patient, comprising administering to the patient autologous erythrocytes that contain thymidine phosphorylase and are free of animal proteins other than proteins derived from the patient. The erythrocytes generally contain a low amount of endotoxin.

Priority: GB20110016767 Applic. Date: 2011-09-28

Inventor: BAX BRIDGET [GB]; BAIN MURRAY [GB]


Publication No.: WO2013049068A1  Published: 04/Apr/2013

Title: METHOD FOR FUNCTIONALIZING A POROUS MEMBRANE COVERING OF AN OPTICAL SENSOR TO FACILITATE COUPLING OF AN ANTITHROM-BOGENIC AGENT

Applicant/Assignee: GLUMETRICS, INC

Application No.: WO2012US57127 (PCT/US2012/57127)   Filing Date: 25/Sep/2012

Abstract:

Methods of covalently attaching heparin to a membrane comprising plasma treating the membrane to produce an amino-functionalized membrane

and reacting the amino-functionalized membrane with heparin under conditions in which heparin becomes covalently attached to the amino-functionalized membrane, wherein said heparin is indirectly attached via a spacer to said amino-functionalized membrane and/or said heparin is attached from a single site in said heparin to a single site on said amino- functionalized membrane or to said spacer. Also disclosed are analyte sensors.

Priority: US201161539832P Applic. Date: 2011-09-27

Inventor: SURI JEFF T [US]; PATTERSON ERIC [US]


Publication No.: WO2013049106A2  Published: 04/Apr/2013

Title: REDUCTION OF IMPLANT INFECTION VIA TUNABLE STIMULATION OF LOCALIZED ADAPTIVE IMMUNE RESPONSE

Applicant/Assignee:

Application No.: WO2012US57194 (PCT/US2012/57194)   Filing Date: 26/Sep/2012

Abstract:

Compositions, implantation devices and methods for stimulating an immune response to infection are discussed. In some examples, the compositions, implantation devices or methods of regulating the amplification of an adaptive immune response to infection involves use of one or more particles locally at a surgical or implant site to control bacterial infections without detrimental systemic side-effects. In some examples, the particles can be coated or layered onto the surface of an implantable device or material. In other examples, the particles can be injected into the site of implantation.

Priority: US201161539282P Applic. Date: 2011-09-26

Inventor: WUSTENBERG WILLIAM [US]; FINCH MICHAEL [US]; MUNSHI CYRUS B [US]


Publication No.: WO2013050445A1  Published: 11/Apr/2013

Title: REMOVAL OF TUMOR CELLS FROM INTRAOPERATIVE AUTOLOGOUS BLOOD SALVAGE

Applicant/Assignee: TRION PHARMA GMBH

Application No.: WO2012EP69584 (PCT/EP2012/69584)   Filing Date: 04/Oct/2012

Abstract:

The invention relates to a method performed ex vivo for removal of tumor cells from intraoperatively collected blood salvage, to antibodies and scaffold proteins which mimic antibodies for use in said ex vivo method, to the use of said ex vivo method for removal of tumor cells from intraoperatively collected blood salvage followed by reintroducing the so obtained purified blood salvage or of concentrates of erythrocytes purified by said method to a patient from whom said intraoperatively collected blood was obtained, as well as to blood salvage or a concentrate of erythrocytes, both obtainable by said method for reinfusion to said patient.

Priority: EP20110183851 Applic. Date: 2011-10-04

Inventor: LINDHOFER HORST [DE]; STROEHLEIN MICHAEL [DE]; HEISS MARKUS [DE]


Publication No.: WO2013052736A2  Published: 11/Apr/2013

Title: METHODS OF TREATING OR PREVENTING BLOOD LOSS DURING SURGERY USING THE SERINE PROTEASE INHIBITOR MDCO-2010

Applicant/Assignee: THE MEDICINES COMPANY

Application No.: WO2012US58859 (PCT/US2012/58859)   Filing Date: 05/Oct/2012

Abstract:

Methods of inhibiting, treating or preventing blood loss in a subject undergoing surgery through the administration of an effective amount of the novel serine protease inhibitor MDCO-2010 or its salts or esters are disclosed.

Priority: US201161544215P Applic. Date: 2011-10-06; US201161547499P Applic. Date: 2011-10-14

Inventor: VAN DE LOCHT ANDREAS [DE]; DIETRICH WULF [DE]; ENGLBERGER LARS [CH]; VILLIGER PETER [US]; VILLIGER JOHN [NZ]


Publication No.: WO2013053937A1  Published: 18/Apr/2013

Title: A DEPROTEINISED CALF BLOOD PREPARATION FOR USE IN PREVENTION OR TREATMENT OF POST-STROKE COGNITIVE IMPAIRMENT

Applicant/Assignee: NYCOMED AUSTRIA GMBH

Application No.: WO2012EP70375 (PCT/EP2012/70375)   Filing Date: 15/Oct/2012

Abstract:

The present invention relates to a deproteinised calf blood preparation for use in the prevention or treatment of post-stroke cognitive impairment, wherein the deproteinised calf blood preparation is administered parenterally 0-10 days after onset of stroke at least once and wherein the parenteral administration is followed by a period of enteral administration. In a preferred embodiment of the present invention, the deproteinised calf blood preparation is administered intravenously after onset of stroke once daily for a period of at the most 20 days, and the intravenous administration is followed by a period of oral administration of about 200 mg of the deproteinised calf blood preparation three times daily for a period of about 6 months or even longer as a substantially continuous treatment. In a preferred embodiment of the present invention, the deproteinised calf blood preparation is the medicament Actovegin TM .

Priority: EP20110185282 Applic. Date: 2011-10-14; EP20120182814 Applic. Date: 2012-09-03

Inventor: VIGONIUS ULF [SE]


Publication No.: WO2013055679A2  Published: 18/Apr/2013

Title: METHOD FOR TREATING THROMBOTIC DISORDERS USING QUERCETIN-CONTAINING COMPOSITIONS

Applicant/Assignee: QUERCEGEN PHARMACEUTICALS LLC

Application No.: WO2012US59341 (PCT/US2012/59341)   Filing Date: 09/Oct/2012

Abstract:

Priority: US201113272508 Applic. Date: 2011-10-13

Inventor: LINES THOMAS CHRISTIAN [US]


Publication No.: WO2013055984A1  Published: 18/Apr/2013

Title: SUBSTITUTED TETRAHYDROISOQUINOLINE COMPOUNDS AS FACTOR XIA INHIBITORS

Applicant/Assignee: BRISTOL-MYERS SQUIBB COMPANY

Application No.: WO2012US59859 (PCT/US2012/59859)   Filing Date: 12/Oct/2012

Abstract:

The present invention provides compounds of Formula (I): or stereoisomers, pharmaceutically acceptable salts thereof, wherein all of the variables are as defined herein. These compounds are inhibitors of factor XIa and/or plasma kallikrein which may be used as medicaments.

Priority: US201161547305P Applic. Date: 2011-10-14

Inventor: ORWAT MICHAEL J [US]; PINTO DONALD J P [US]; SMITH II LEON M [US]; SRIVASTAVA SHEFALI [IN]; CORTE JAMES R [US]


Publication No.: WO2013056034A1  Published: 18/Apr/2013

Title: SUBSTITUTED TETRAHYDROISOQUINOLINE COMPOUNDS AS FACTOR XIA INHIBITORS

Applicant/Assignee: BRISTOL-MYERS SQUIBB COMPANY

Application No.: WO2012US59932 (PCT/US2012/59932)   Filing Date: 12/Oct/2012

Abstract:

The present invention provides compounds of Formula (I) or stereoisomers, pharmaceutically acceptable salts thereof, wherein all of the variables are as defined herein. These compounds are inhibitors of factor XIa and/or plasma kallikrein which may be used as medicaments.

Priority: US201161547301P Applic. Date: 2011-10-14

Inventor: ORWAT MICHAEL J [US]; PINTO DONALD J P [US]; SMITH II LEON M [US]; SRIVASTAVA SHEFALI [IN]


Publication No.: WO2013056060A1  Published: 18/Apr/2013

Title: SUBSTITUTED TETRAHYDROISOQUINOLINE COMPOUNDS AS FACTOR XIA INHIBITORS

Applicant/Assignee: BRISTOL-MYERS SQUIBB COMPANY

Application No.: WO2012US59969 (PCT/US2012/59969)   Filing Date: 12/Oct/2012

Abstract:

The present invention provides compounds of Formula (I): or stereoisomers, pharmaceutically acceptable salts thereof, wherein all of the variables are as defined herein. These compounds are inhibitors of factor XIa and/or plasma kallikrein which may be used as medicaments.

Priority: US201161547292P Applic. Date: 2011-10-14

Inventor: ORWAT MICHAEL J [US]; PINTO DONALD J P [US]; SMITH II LEON M [US]; SRIVASTAVA SHEFALI [IN]


Publication No.: WO2013057219A1  Published: 25/Apr/2013

Title: METHOD FOR IMPROVING THE STABILITY OF PURIFIED FACTOR VIII AFTER RECONSTITUTION

Applicant/Assignee: CSL BEHRING GMBH

Application No.: WO2012EP70701 (PCT/EP2012/70701)   Filing Date: 18/Oct/2012

Abstract:

The present invention relates to a method for increasing the stability of a Factor VIII molecule after purification, lyophilization and reconstitution, comprising preventing proteolytic cleavage of the Factor VIII molecule into a first fragment comprising essentially the A1 domain and the A2 domain and a second fragment comprising essentially the A3 domain, the C1 domain and the C2 domain throughout manufacturing of the Factor VIII molecule. The invention further pertains to a method for improving the bioavailability of Factor VIII after intravenous and non- intravenous injection.

Priority: EP20110185651 Applic. Date: 2011-10-18; US201161548601P Applic. Date: 2011-10-18

Inventor: HORN CARSTEN [DE]; ZOLLNER SABINE [DE]; METZNER HUBERT [DE]; SCHULTE STEFAN [DE]


Publication No.: WO2013062489A1  Published: 02/May/2013

Title: LYMPHATIC VESSEL ENDOTHELIAL HYALURONIC ACID RECEPTOR-1 (LYVE-1+) MACROPHAGES AND USES THEREOF

Applicant/Assignee: NATIONAL UNIVERSITY OF SINGAPORE

Application No.: WO2012SG00405 (PCT/SG2012/00405)   Filing Date: 25/Oct/2012

Abstract:

The invention is directed to a method for maintaining structure, homeostasis, repairing or treating media thinning of one or more blood vessels as well as treating atherosclerosis or ischaemic heart disease. The method comprises contacting the blood vessel with LYVE-1+ macrophages either directly or by local administration of M-CSF to recruit endogenous LYVE-1 macrophages to the blood vessel, wherein the blood vessel's media comprises smooth muscle cells.

Priority: US201161552847P Applic. Date: 2011-10-28

Inventor: ANGELI VERONIQUE [SG]; MARTINEZ VALENCIA ELIANA CECILIA [SG]


Publication No.: WO2013062495A2  Published: 02/May/2013

Title: A TUBE TO PRODUCE PLATELET RICH FIBRIN

Applicant/Assignee:

Application No.: WO2012TR00164 (PCT/TR2012/00164)   Filing Date: 03/Oct/2012

Abstract:

Invention

It is about the tubes used to obtain blood products through centrifuge in order to cure open and closed injuries, to heal hard and soft tissues and to diagnose in all fields of medicine and dentistry. Platelet Rich Fibrin (PRF) obtained in the tubes the surface of which contacts blood and made from pure titanium or titanium alloys has a better structure of fibrin than that is obtained through classical methods. The efficiency of the high speed centrifuge is increased with this designed tube and Platelet Rich Fibrin can be removed from the tube without spoiling it.

Priority: TR20110009999 Applic. Date: 2011-10-10

Inventor: SERHAN AKMAN [TR]; MUSTAFA TUNALI [TR]


Publication No.: WO2013063068A1  Published: 02/May/2013

Title: FACTOR IXA INHIBITORS

Applicant/Assignee: MERCK SHARP & DOHME CORP, MOCHIDA PHARMACEUTICAL CO., LTD, ALBANY MOLECULAR RESEARCH, INC

Application No.: WO2012US61625 (PCT/US2012/61625)   Filing Date: 24/Oct/2012

Abstract:

The present invention provides a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof. The present invention also provides pharmaceutical compositions comprising one or more said compounds, and methods for using said compounds for treating or preventing a thromboses, embolisms, hypercoagulability or fibrotic changes.

Priority: US201161551977P Applic. Date: 2011-10-27

Inventor: CHACKALAMANNIL SAMUEL [US]; OHKOUCHI MUNETAKA [JP]; VOSS MATTHEW [SG]; SONE HIROKI [SG]


Publication No.: WO2013063155A2  Published: 02/May/2013

Title: COMPANION DIAGNOSTIC FOR ANTI-HYALURONAN AGENT THERAPY AND METHODS OF USE THEREOF

Applicant/Assignee: HALOZYME, INC

Application No.: WO2012US61743 (PCT/US2012/61743)   Filing Date: 24/Oct/2012

Abstract:

Methods and diagnostic agents for identification of subjects for cancer treatment with an anti-hyaluronan agent, such as a hyaluronan-degrading enzyme, are provided. Diagnostic agents for the detection and quantification of hyaluronan in a biological sample and monitoring cancer treatment with an anti-hyaluronan agent, for example a hyaluronan-degrading enzyme, are provided. Combinations and kits for use in practicing the methods also are provided.

Priority: US201161628187P Applic. Date: 2011-10-24; US201161559011P Applic. Date: 2011-11-11; US201161630765P Applic. Date: 2011-12-16; US201261714700P Applic. Date: 2012-10-16

Inventor: JIANG PING [US]; SHEPARD H MICHAEL [US]; HUANG LEI [US]


Publication No.: WO2013063536A1  Published: 02/May/2013

Title: ACTRIIB BINDING AGENTS AND USES THEREOF

Applicant/Assignee: ACCELERON PHARMA, INC

Application No.: WO2012US62321 (PCT/US2012/62321)   Filing Date: 27/Oct/2012

Abstract:

The disclosure provides, among other aspects, neutralizing antibodies and portions thereof that bind to ActRIIB and uses for same.

Priority: US201161552434P Applic. Date: 2011-10-27; US201113283552 Applic. Date: 2011-10-27

Inventor: KUMAR RAVINDRA [US]; GRINBERG ASYA [US]; DAVIES MONIQUE [US]; MARTIK DIANA [US]; COSIC JANJA [US]; KENT RACHEL [US]; BUCKLER DAVID [US]


Publication No.: WO2013069016A2  Published: 16/May/2013

Title: LONG LASTING DRUG FORMULATIONS

Applicant/Assignee: MEDGENICS MEDICAL ISRAEL LTD

Application No.: WO2012IL50448 (PCT/IL2012/50448)   Filing Date: 08/Nov/2012

Abstract:

The present invention is directed to long-lasting erythropoietin therapeutic formulations and their methods of use wherein the formulation comprises a genetically modified micro-organ that comprises a vector which comprises a nucleic acid sequence operably linked to one or more regulatory sequences, wherein the nucleic acid sequence encodes erythropoietin.

Priority: US201161557451P Applic. Date: 2011-11-09; US201213346761 Applic. Date: 2012-01-10; US201261672962P Applic. Date: 2012-07-18

Inventor: PEARLMAN ANDREW L [IL]; STERN BARUCH S [IL]


Publication No.: WO2013070623A1  Published: 16/May/2013

Title: AN EXTENDED RELEASE FORMULATION OF A DIRECT THROMBIN INHIBITOR

Applicant/Assignee: DIAKRON PHARMACEUTICALS INC

Application No.: WO2012US63734 (PCT/US2012/63734)   Filing Date: 06/Nov/2012

Abstract:

Extended release formulations of 3-fluoro-2-pyridylmethyl-3-(2,2-difluoro-2-(2- pyridyl)ethylamino)-6-chloropyrazin-2-one-l-acetamide (DPOC-4088) that provide for better control of blood plasma levels. The extended release formulations maintain substantially constant plasma levels of the active ingredient for at least about 16 hours and provide for once-daily dosing.

Priority: US201161556771P Applic. Date: 2011-11-07

Inventor: RAMAKRISHNAN SANKAR [IN]; VENKATESAN ELUMALAI [IN]; SURYAKUMAR JAYANTHI [IN]; ALLARD STEPHANE [US]


Publication No.: WO2013070657A1  Published: 16/May/2013

Title: MODULATORS OF THE G PROTEIN-COUPLED MAS RECEPTOR AND THE TREATMENT OF DISORDERS RELATED THERETO

Applicant/Assignee: ARENA PHARMACEUTICALS, INC

Application No.: WO2012US63793 (PCT/US2012/63793)   Filing Date: 07/Nov/2012

Abstract:

The present invention relates to compounds of Formula (I) and pharmaceutically acceptable salts, solvates, and hydrates thereof that are useful in methods of treatment and alleviation of diseases and disorders of the heart, brain, kidney, immune, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto. The present invention further relates to methods of treatment and alleviation of diseases and disorders of the vasculature resulting from vasoconstriction or hypertension and any downstream complication(s) resulting from elevated blood pressure and/or reduced tissue perfusion.

Priority: US201161557088P Applic. Date: 2011-11-08; US201261718290P Applic. Date: 2012-10-25

Inventor: TRAN THUY-ANH [US]; BLACKBURN ANTHONY C [US]; KRAMER BRYAN A [US]; NAGURA MAIKO [US]; SAGE CARLETON R [US]; SHIN YOUNG-JUN [US]; ZOU NING [US]


Publication No.: WO2013078316A1  Published: 30/May/2013

Title: RECOMBINANT ADENO-ASSOCIATED VIRUS DELIVERY OF ALPHA-SARCOGLYCAN POLYNUCLEOTIDES

Applicant/Assignee: NATIONWIDE CHILDREN'S HOSPITAL, INC

Application No.: WO2012US66265 (PCT/US2012/66265)   Filing Date: 21/Nov/2012

Abstract:

The present invention relates to recombinant adeno-associated virus (rAAV) delivery of an alpha-sarcoglycan gene. The invention provides rAAV products and methods of using the rAAV in the treatment of limb girdle muscular dystrophies such as LGMD2D.

Priority: US201161563139P Applic. Date: 2011-11-23

Inventor: MENDELL JERRY R [US]; CHICOINE LOUIS [US]; RODINO-KLAPAC LOUISE [US]; CLARK KELLY REED [US]; PRESTON THOMAS J [US]


Publication No.: WO2013078335A1  Published: 30/May/2013

Title: CYSTEAMINE AND/OR CYSTAMINE FOR TREATING ISCHEMIC INJURY

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2012US66288 (PCT/US2012/66288)   Filing Date: 21/Nov/2012

Abstract:

Provided herein are methods and compositions for treating ischemia or a disease or disorder that causes ischemia comprising contacting a subject with cysteamine, a cysteamine derivative, cystamine or a cystamine derivative. The disclosure also provides methods of modulating adiponectin levels in a subject comprising contact a subject with cysteamine, a cysteamine derivative, cystamine or a cystamine derivative.

Priority: US201161563034P Applic. Date: 2011-11-22

Inventor: DOHIL RANJAN [US]; PHILLIPS SUSAN A [US]


Publication No.: WO2013080208A1  Published: 06/Jun/2013

Title: METHODS FOR PROVIDING A PERSONALISED LIST OF DIETARY NUTRIENTS AND SUPPLEMENTS

Applicant/Assignee: PRANA ESSENTIALS LTD

Application No.: WO2012IL50487 (PCT/IL2012/50487)   Filing Date: 29/Nov/2012

Abstract:

The present invention provides methods for providing a personalized list of dietary nutraceuticals to an individual, wherein at least one of the nutraceuticals affects the bioavailability of at least one other of the nutraceuticals, the methods including adjusting the amount of the affected nutraceutical based on the influence of the affecting nutraceutical on the bioavailability thereof. The present invention further provides a computerized system including a database and a processor which includes modules configured for providing the list of nutraceuticals according to the invention.

Priority: US201161565819P Applic. Date: 2011-12-01

Inventor: ARONIS ZEEV [IL]; LOITER TOMMER [IL]; MEERFELD YARON [IL]


Publication No.: WO2013082071A1  Published: 06/Jun/2013

Title: TRIMETHYLAMINE-CONTAINING COMPOUNDS FOR DIAGNOSIS AND PREDICTION OF DISEASE

Applicant/Assignee: THE CLEVELAND CLINIC FOUNDATION

Application No.: WO2012US66731 (PCT/US2012/66731)   Filing Date: 28/Nov/2012

Abstract:

The present invention provides markers and methods for determining whether a subject, particularly a human subject, has or is at risk of developing, a disease such as cardiovascular disease, diabetes mellitus, insulin resistance, metabolic syndrome, NAFLD (Nonalcoholic Fatty Liver Disease) or NASH (Nonalcoholic Steatohepatitis) (e.g., within the ensuing year, two years, and/or three years). The present application also relates to the use of such markers and methods for monitoring the status of such diseases in a subject or the effects of therapeutic agents on subjects with such diseases.

Priority: US201113304806 Applic. Date: 2011-11-28

Inventor: HAZEN STANLEY L [US]; WANG ZENENG [US]; LEVISON BRUCE L [US]


Publication No.: WO2013082210A1  Published: 06/Jun/2013

Title: ANTICOAGULANT REVERSAL AGENTS

Applicant/Assignee: PEROSPHERE INC

Application No.: WO2012US66938 (PCT/US2012/66938)   Filing Date: 29/Nov/2012

Abstract:

Novel anticoagulant reversal compounds are disclosed, as well as methods of making the compounds, pharmaceutical compositions including the compounds, methods of using the compounds to reverse the anticoagulant effects of coagulation inhibitors, and diagnostic assays comprising the compounds.

Priority: US201161564559P Applic. Date: 2011-11-29; US201261614292P Applic. Date: 2012-03-22; US201261641698P Applic. Date: 2012-05-02; US201261666291P Applic. Date: 2012-06-29

Inventor: STEINER SOLOMON S [US]; LAULICHT BRYAN E [US]; BAKHRU SASHA H [US]; MATHIOWITZ EDITH [US]


Publication No.: WO2013082458A1  Published: 06/Jun/2013

Title: REPERFUSION PROTECTION SOLUTION AND USES THEREOF

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2012US67348 (PCT/US2012/67348)   Filing Date: 30/Nov/2012

Abstract:

In various embodiments a reperfusion protection solution (RPS) is provided along with methods of use thereof. Illustrative reperfusion protection solutions include, but are not limited to a buffer

one or more substrates for the synthesis of adenosine triphosphate (ATP) under anaerobic conditions

citrate-phosphate-dextrose (CPD)

and one or more amino acids that stabilize cell membranes. Typically the pH of the organ reperfusion protection solution ranges from about pH 8.1 to about pH 8.4.

Priority: US201161566419P Applic. Date: 2011-12-02

Inventor: HONG JOHNNY C [US]


Publication No.: WO2013082562A1  Published: 06/Jun/2013

Title: PREBIOTIC FORMULATIONS AND METHODS OF USE

Applicant/Assignee: RITTER PHARMACEUTICALS, INC

Application No.: WO2012US67488 (PCT/US2012/67488)   Filing Date: 30/Nov/2012

Abstract:

Provided are methods and pharmaceutical compositions for treating symptoms associated with lactose intolerance and for overall improvement in gastrointestinal health. Described herein are methods and pharmaceutical compositions for improving overall gastrointestinal health or for decreasing symptoms of lactose intolerance by administering to subject in need thereof a pharmaceutical composition comprising a prebiotic, optionally in combination with effective amount of a probiotic microbe or microbes.

Priority: US201161565308P Applic. Date: 2011-11-30; US201261646820P Applic. Date: 2012-05-14

Inventor: RITTER ANDREW J [US]; SAVAIANO DENNIS [US]; BARNES DAVID [US]; KLAENHAMMER TODD [US]


Publication No.: WO2013086436A1  Published: 13/Jun/2013

Title: COMPOSITIONS AND METHODS FOR ENHANCED GENERATION OF HEMATOPOIETIC STEM/PROGENITOR CELLS

Applicant/Assignee: FRED HUTCHINSON CANCER RESEARCH CENTER, NOVARTIS INSTITUTE FOR FUNCTIONAL GENOMICS, INC.,DBA THE GENOMICS INSTITUTE OF THE NORVATIS RESEARCH

Application No.: WO2012US68599 (PCT/US2012/68599)   Filing Date: 07/Dec/2012

Abstract:

The present invention relates to methods, kits and compositions for expansion of hematopoietic stem/progenitor cells and providing hematopoietic function to human patients in need thereof. In one aspect, it relates to kits and compositions comprising a Notch agonist and an aryl hydrocarbon receptor antagonist. Also provided herein are methods for expanding the hematopoietic stem/progenitor cells using kits and compositions comprising a Notch agonist and an aryl hydrocarbon receptor antagonist. The hematopoietic stem/progenitor cells expanded using the disclosed kits, compositions and methods include human umbilical cord blood stem/progenitor cells, placental cord blood stem/progenitor cells and peripheral blood stem cells. The present invention also relates to administering hematopoietic stem/progenitor cells expanded using a combination of a Notch agonist and an aryl hydrocarbon receptor antagonist to a patient for short-term and/or long-term in vivo repopulation benefits.

Priority: US201161568573P Applic. Date: 2011-12-08

Inventor: BERNSTEIN IRWIN D [US]; BOITANO ANTHONY E [US]; COOKE MICHAEL [US]


Publication No.: WO2013086443A1  Published: 13/Jun/2013

Title: AGONISTIC HUMAN LCAT ANTIGEN BINDING PROTEINS AND THEIR USE IN THERAPY

Applicant/Assignee: AMGEN INC

Application No.: WO2012US68608 (PCT/US2012/68608)   Filing Date: 07/Dec/2012

Abstract:

Antigen binding proteins that activate LCAT are provided. Nucleic acids encoding the antigen binding proteins and vectors and cells containing such nucleic acids are also provided. The antigen binding proteins have value in therapeutic methods in which it is useful to modulate HDL particle size, increase plasma levels of HDL-C, and increase reverse cholesterol transport. Accordingly, the antigen binding proteins have utility in the treatment and prevention of atherosclerosis, various cardiovascular diseases and cholesterol-related disorders, inflammatory conditions, thrombosis-related conditions, metabolic syndrome, diabetes and insulin-resistance. The LCAT antigen binding proteins are also useful in treating the consequences, symptoms, and/or pathology associated with either genetic or acquired LCAT deficiency, including chronic kidney disease (CKD).

Priority: US201161568448P Applic. Date: 2011-12-08; US201261731408P Applic. Date: 2012-11-29

Inventor: MEININGER DAVID P [US]; WITTEKIND MICHAEL [US]; DELANEY JOHN M [US]; ZHOU MINGYUE [US]; PIPER DEREK E [US]


Publication No.: WO2013086493A1  Published: 13/Jun/2013

Title: COMPOSITIONS AND METHODS FOR THE GENERATION OF ACTIVATED PROTEIN C AND METHODS OF USE THEREOF

Applicant/Assignee: THE CHILDREN'S HOSPITAL OF PHILADELPHIA

Application No.: WO2012US68743 (PCT/US2012/68743)   Filing Date: 10/Dec/2012

Abstract:

Compositions and methods for generating activated protein C and methods of thereof are disclosed.

Priority: US201161568853P Applic. Date: 2011-12-09

Inventor: PONCZ MORTIMER [US]; KOWALSKA MARIA ANNA [US]


Publication No.: WO2013087234A1  Published: 20/Jun/2013

Title: NANOPARTICLES AND USES THEREOF

Applicant/Assignee: BIOCANT ASSOCIACAO DE TRANSFERENCIA DE TECNOLOGIA

Application No.: WO2012EP65550 (PCT/EP2012/65550)   Filing Date: 08/Aug/2012

Abstract:

A nanoparticle conjugate for intracellular delivery of a therapeutic agent, wherein the conjugate comprises a nanoparticle, a cationic agent and the therapeutic agent. Pharmaceutical compositions, medicaments and therapeutic uses thereof are also provided.

Priority: EP20110398008 Applic. Date: 2011-12-16

Inventor: DA SILVA FERREIRA LINO [PT]; NEVES PIRES DAS NEVES RICARDO [PT]; GOMES RENATA SOFIA MOTA [GB]


Publication No.: WO2013088255A1  Published: 20/Jun/2013

Title: PRODRUGS OF SECONDARY AMINE COMPOUNDS

Applicant/Assignee: ALKERMES PHARMA IRELAND LIMITED

Application No.: WO2012IB02992 (PCT/IB2012/02992)   Filing Date: 14/Dec/2012

Abstract:

The present invention relates to compounds of Formula (I).

Priority: US201161576244P Applic. Date: 2011-12-15

Inventor: BLUMBERG LAURA COOK [US]; LOWE JOHN ADAM [US]; ALMARSSON ORN [US]; ALVAREZ JUAN [US]; ZEIDAN TAREK A [US]


Publication No.: WO2013090557A2  Published: 20/Jun/2013

Title: PTEROSTILBENE AND PVP GRAPE JUICE EXTRACT COMBINATION FOR TREATMENT OF METABOLIC, VASCULAR, AND NEURODEGENERATIVE DISORDERS

Applicant/Assignee: CHROMADEX INC, CLIFFSTAR LLC

Application No.: WO2012US69485 (PCT/US2012/69485)   Filing Date: 13/Dec/2012

Abstract:

A pharmaceutical composition is provided comprising a therapeutically effective amount of pterostilbene, a therapeutically effective amount of a polyphenolic-PVP extract of grape juice, and a pharmaceutically acceptable carrier. The embodiments of the pharmaceutical compositions can have lipid lowering properties, or alternatively can have properties that can treat oxidative stress, by decreasing inflammation or inflammatory processes contributing to neurodegenerative diseases. A method of lowering lipid levels in an individual is also provided, comprising administering to the individual in need of such treatment a pharmaceutical composition including a therapeutically effective amount of pterostilbene, a therapeutically effective amount of a polyphenolic-PVP extract of grape juice, and a pharmaceutically acceptable carrier, wherein lipid levels are decreased.

Priority: US201213712747 Applic. Date: 2012-12-12; US201161570048P Applic. Date: 2011-12-13

Inventor: BARTOS JEREMY [US]; LYNCH DOUGLAS [US]


Publication No.: WO2013090776A1  Published: 20/Jun/2013

Title: INHIBITION OF AXL/GAS6 SIGNALING IN THE TREATMENT OF DISEASE

Applicant/Assignee: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY, RUGA CORPORATION

Application No.: WO2012US69841 (PCT/US2012/69841)   Filing Date: 14/Dec/2012

Abstract:

Compositions and methods are provided for alleviating endometriosis, kidney disease, inflammatory disease and/or transplant rejection in a mammal by administering a therapeutic dose of a pharmaceutical composition that inhibits AXL, MER or Tyro3 protein activity, for example by competitive or non-competitive inhibition of the binding interaction between AXL, MER or Tyro3 and its ligand GAS6.

Priority: US201161576304P Applic. Date: 2011-12-15

Inventor: O'CONNOR PATRICK [US]; TABIBIAZAR RAYMOND [US]; GIACCIA AMATO J [US]; RANKIN ERINN BRUNO [US]; COCHRAN JENNIFER R [US]; JONES DOUGLAS [US]; KARIOLIS MIHALIS [US]; FUH KATHERINE [US]; MIAO YU [US]


Publication No.: WO2013090891A1  Published: 20/Jun/2013

Title: CONTROLLED RELEASE VEHICLES HAVING DESIRED VOID VOLUME ARCHITECTURES

Applicant/Assignee: CELANESE EVA PERFORMANCE POLYMERS, INC

Application No.: WO2012US70058 (PCT/US2012/70058)   Filing Date: 17/Dec/2012

Abstract:

Controlled release vehicles may include a polymeric matrix that comprises the polymeric matrix comprising at least one selected from the group consisting of an ethylene copolymer, an ethyl cellulose, a thermoplastic polyurethane, any partially crosslinked polymer thereof, and any combination thereof and has a desired void space architecture.

Priority: US201261576751P Applic. Date: 2012-07-03; US201261667680P Applic. Date: 2012-07-03; US201261667619P Applic. Date: 2012-07-03

Inventor: REYES JOSE [US]; ANDERSON KENNETH [US]; ZEVOTEK DALE [US]; REUTER NATHAN [US]; LITTLE J GREGORY [US]; HALEY JEFFREY [US]; GALIATSATOS VASSILIOS [US]


Publication No.: WO2013093027A1  Published: 27/Jun/2013

Title: USE OF C1-INHIBITOR FOR THE TREATMENT OF SECONDARY EDEMA OF THE CENTRAL NERVOUS SYSTEM

Applicant/Assignee: CSL BEHRING GMBH, JULIUS-MAXIMILIANS-UNIVERSITAET-WUERZBURG

Application No.: WO2012EP76691 (PCT/EP2012/76691)   Filing Date: 21/Dec/2012

Abstract:

The subject of the present invention is, in the most general aspect, the prevention and/or treatment of a secondary edema. In particular, the present invention relates to a C1-Inhibitor for use in a method of preventing the formation and/or reducing the size of a secondary edema of the central nervous system (CNS) in a subject wherein the subject has or has had at least one disorder selected from the group consisting of stroke, ischemic stroke, hemorrhagic stroke, perinatal stroke, traumatic brain injury and spinal cord injury. Preferably the secondary edema of the CNS is a secondary brain edema. Another subject of the present invention is the treatment of disorders associated with an increased permeability of the blood brain barrier or the blood spinal cord barrier. And a third subject is a plasma-derived C1-inhibitor for use in a method of preventing, reducing or treating brain ischemia-reperfusion injury.

Priority: EP20110195254 Applic. Date: 2011-12-22; US201261587371P Applic. Date: 2012-01-17

Inventor: KLEINSCHNITZ CHRISTOPH [DE]; NOLTE MARC [DE]; STOLL GUIDO [DE]; DICKNEITE GERHARD [DE]; SCHULTE STEFAN [DE]; NIESWANDT BERNHARD [DE]; PRAGST INGO [DE]


Publication No.: WO2013093484A1  Published: 27/Jun/2013

Title: PYRIDINONE AND PYRIMIDINONE DERIVATIVES AS FACTOR XIA INHIBITORS

Applicant/Assignee: ONO PHARMACEUTICAL CO., LTD

Application No.: WO2012GB53217 (PCT/GB2012/53217)   Filing Date: 20/Dec/2012

Abstract:

The present invention provides compounds of the general formula (I), their salts and N- oxides, and solvates and prodrugs thereof (wherein the characters are as defined in the description). The compounds of the general formula (I) are inhibitors of Factor XIa, so that they are useful in the prevention of and/or therapy for thromboembolic diseases.

Priority: GB20110022139 Applic. Date: 2011-12-21; GB20120017290 Applic. Date: 2012-09-27

Inventor: COURTNEY STEVE [GB]; YARNOLD CHRIS [GB]; FLANAGAN STUART [GB]; BRACE GARETH [GB]; BARKER JOHN [GB]; ICHIHARA OSAMU [GB]; GADOULEAU ELISE [GB]; RICHARDSON ANTHONY [GB]; KONDO TAKASHI [JP]; IMAGAWA AKIRA [JP]; NAKATANI SHINGO [JP]; SUZUKI RYO [JP]; KOUYAMA SHO [JP]


Publication No.: WO2013095270A1  Published: 27/Jun/2013

Title: AN AQUEOUS SOLUTION COMPRISING A MACROMOLECULAR CONJUGATE OF HEPARIN FOR THE TREATMENT OF BLOOD VESSELS

Applicant/Assignee: CORLINE SYSTEMS AB

Application No.: WO2012SE51410 (PCT/SE2012/51410)   Filing Date: 17/Dec/2012

Abstract:

The present invention relates to a solution for treating blood vessels where the solution comprises a heparin conjugate. The invention further relates to the use of the conjugate as a medicament and a method of coating tissue using the conjugate.

Priority: SE20110051266 Applic. Date: 2011-12-22

Inventor: LARSSON ROLF [SE]


Publication No.: WO2013096741A2  Published: 27/Jun/2013

Title: ORGANOIDS COMPRISING DECELLULARIZED AND REPOPULATED PLACENTAL VASCULAR SCAFFOLD

Applicant/Assignee: ANTHROGENESIS CORPORATION

Application No.: WO2012US71192 (PCT/US2012/71192)   Filing Date: 21/Dec/2012

Abstract:

Provided herein are organoids comprising decellularized placental vascular scaffold comprising, or consisting of, a decellularized placental vascular scaffold, and methods of making and using the same.

Priority: US201261696527P Applic. Date: 2012-09-04; US201261592350P Applic. Date: 2012-01-30; US201161579942P Applic. Date: 2011-12-23

Inventor: BHATIA MOHIT B [US]; HARIRI ROBERT J [US]; HOFGARTNER WOLFGANG [US]; WANG JIA-LUN [US]; YI QIAN [US]


Publication No.: WO2013102626A1  Published: 11/Jul/2013

Title: 3-[4-(PHENYLAMINOOXALYLAMINO)PHENYL]HEX-4-YNOIC ACIDS, PROCESS FOR PREPARATION THEREOF AND USE THEREOF AS A MEDICAMENT

Applicant/Assignee: SANOFI

Application No.: WO2013EP50005 (PCT/EP2013/50005)   Filing Date: 02/Jan/2013

Abstract:

The invention relates to 3-[4-(phenylaminooxalylamino)phenyl]hex-4-ynoic acids, and to physiologically compatible salts thereof. The invention relates to compounds of the formula (I) in which R1, R2, R3 and R4 are each defined as specified, and to physiologically compatible salts thereof. The compounds are suitable, for example, for treatment of diabetes.

Priority: EP20120305008 Applic. Date: 2012-01-04; US201261669440P Applic. Date: 2012-07-09; EP20120306086 Applic. Date: 2012-09-10

Inventor: DEFOSSA ELISABETH [DE]; DIETRICH VIKTORIA [DE]; KLABUNDE THOMAS [DE]; KEIL STEFANIE [DE]; STENGELIN SIEGFRIED [DE]; HASCHKE GUIDO [DE]; HERLING ANDREAS [DE]; KUHLMANN-GOTTKE JOHANNA [DE]; BARTOSCHEK STEFAN [DE]; GESSLER SIMON [DE]; DUDDA ANGELA [DE]; BILLEN GUENTER [DE]; OLPP THOMAS [DE]; RIEKE-ZAPP JOERG [DE]


Publication No.: WO2013103567A2  Published: 11/Jul/2013

Title: METHODS OF BLOCKING PLATELET ACTIVATION DURING EXTRACORPOREAL CIRCULATION USING CANGRELOR

Applicant/Assignee: THE MEDICINES COMPANY

Application No.: WO2012US71666 (PCT/US2012/71666)   Filing Date: 26/Dec/2012

Abstract:

Priority: US201261582994P Applic. Date: 2012-01-04

Inventor: KRAJEWSKI STEFANIE [DE]; KURZ JULIA [DE]; NEUMANN BERND [DE]; GREINER TIM O [DE]; STOLZ ANGELIKA [DE]; BALKAU BEVERLEY [FR]; PETER KARLHEINZ [AU]; UNERTL KLAUS [DE]; WENDEL HANS PETER [DE]; STRAUB ANDREAS [DE]


Publication No.: WO2013104698A1  Published: 18/Jul/2013

Title: SCARRING REDUCING WOUND TREATMENT

Applicant/Assignee: SASTOMED GMBH

Application No.: WO2013EP50374 (PCT/EP2013/50374)   Filing Date: 10/Jan/2013

Abstract:

The present invention refers to the use of hemoglobin or myoglobin charged with a non-oxygen ligand for improved scarring of wounds.

Priority: EP20120000176 Applic. Date: 2012-01-13

Inventor: SANDER MICHAEL [DE]


Publication No.: WO2013106433A1  Published: 18/Jul/2013

Title: CELLULOSE DERIVATIVES FOR INHIBITING CRYSTALLIZATION OF POORLY WATER-SOLUBLE DRUGS

Applicant/Assignee: VIRGINIA TECH INTELLECTUAL PROPERTIES, INC, PERDUE RESEARCH FOUNDATION

Application No.: WO2013US20835 (PCT/US2013/20835)   Filing Date: 09/Jan/2013

Abstract:

The present invention relates to the fields of chemistry and pharmaceuticals. Embodiments of the invention provide cellulose esters useful for inhibiting solution crystallization of drugs. Specific polymers of the invention include cellulose esters of formula (I) : wherein n of the omega-carboxyalkanoyl group, Formula (II), is 3, 4, 6, or 8 to provide a omega-carboxyalkanoyl group chosen from succinoyl, glutaroyl, adipoyl, sebacyl, and suberyl groups

and wherein R is chosen from : a hydrogen atom

and an alkanoyl group chosen from acetyl, propionyl, butyryl, valeroyl, hexanoyl, nonanoyl, decanoyl, lauroyl, palmitoyl, and stearoyl groups

wherein there is a total degree of substitution of the alkanoyl group and the omega-carboxyalkanoyl group of at least 2.0

and wherein the polymer comprises m repeating units where n = 1 to 1,000,000, or 10 to 100,000, or 100 to 1,000, such as 1 to 6,000. Embodiments further include compositions comprising cellulose esters and poorly water-soluble drugs, which compositions exhibit greater solubility and stability in solution as compared to the drugs alone. Drugs that can be used in combination with such polymers include but are not limited to ritonavir, efavirenz, etravirine, celecoxib, clarithromycin, curcumin, ellagic acid, quercetin, naringenin, and resveratrol. Methods for making and using the compounds and compositions are also included within the scope of the invention.

Priority: US201261584547P Applic. Date: 2012-01-09; US201261624030P Applic. Date: 2012-04-13; US201261718111P Applic. Date: 2012-10-24

Inventor: EDGAR KEVIN J [US]; LI BIN [US]; TAYLOR LYNNE [US]; ILEVBARE GRACE [US]; WILLIAMS STEPHANIE M [US]; LIU HAOYU [US]


Publication No.: WO2013109991A1  Published: 25/Jul/2013

Title: SUBSTITUTED HETEROCYCLIC COMPOUNDS FOR DISEASE TREATMENT

Applicant/Assignee: ACUCELA INC

Application No.: WO2013US22304 (PCT/US2013/22304)   Filing Date: 18/Jan/2013

Abstract:

The present invention relates generally to compositions and methods for treating neurodegenerative diseases and disorders, particularly ophthalmic diseases and disorders. Provided herein are substituted heterocyclic amine derivative compound and pharmaceutical compositions comprising these compounds. The subject compositions are useful for treating and preventing ophthalmic diseases and disorders, including age-related macular degeneration (AMD) and Stargardt's Disease.

Priority: US201261589108P Applic. Date: 2012-01-20

Inventor: KUKSA VLADIMIR A [US]; ORME MARK W [US]; HONG FENG [US]; KUBOTA RYO [US]


Publication No.: WO2013110006A2  Published: 25/Jul/2013

Title: COMPOSITIONS AND METHODS OF USE OF PHORBOL ESTERS

Applicant/Assignee: BIOSUCCESS BIOTECH CO. LTD

Application No.: WO2013US22324 (PCT/US2013/22324)   Filing Date: 18/Jan/2013

Abstract:

Methods and compositions containing a phorbol ester or a derivative of a phorbol ester are provided for the treatment of chronic and acute conditions. Such conditions may be caused by disease, be symptoms or sequelae of disease. Chronic and acute conditions may be due to viral infections such as HIV and AIDS, neoplastic diseases stroke, kidney disease, urinary incontinence, autoimmune disorders, Parkinson's disease, prostate hypertrophy, aging, or the treatment of such diseases. Additional compositions and methods are provided which employ a phorbol ester or derivative compound in combination with at least one additional agent to yield more effective treatment tools against acute and chronic conditions in mammalian subjects.

Priority: US201261588165P Applic. Date: 2012-01-18; US201261588167P Applic. Date: 2012-01-18; US201261588162P Applic. Date: 2012-01-18

Inventor: CHANG RICHARD L [US]; HAN ZHENG TAO [CN]


Publication No.: WO2013111130A1  Published: 01/Aug/2013

Title: A SYSTEM AND METHOD FOR OBTAINING A CELLULAR SAMPLE ENRICHED WITH DEFINED CELLS SUCH AS PLATELET RICH PLASMA(PRP)

Applicant/Assignee: ESTAR TECHNOLOGIES LTD

Application No.: WO2013IL50061 (PCT/IL2013/50061)   Filing Date: 23/Jan/2013

Abstract:

The invention relates to a system and method for obtaining a cellular fraction enriched with defined cells effective in promoting a defined cellular response from an in vivo cellular sample comprising: a collection tube for collecting a cell suspension (l),an anticoagulant portion(4),a portion of separation gel(3),a first collection syringe for collecting a cell depleted fluid(10),a second collection syringe for collecting the enriched cellular portion(l 1) and at least one needle(lO) for attaching to each syringe. The system is closable to the atmosphere, further whereinthe cell suspension collection tube contains the gel(3) and the anticoagulant(4),the tube is adapted such that, when containing cell suspensionand centrifuged after treatment yields separation fractions, a first fraction comprisingcellular fluid (6), a second fraction comprises gel layer(3),a third fraction comprises enriched cellular portion (7) on top of the gel layer and a fourth fraction comprises a cell poor portion (8).

Priority: US201261589401P Applic. Date: 2012-01-23

Inventor: ESTERON AARON [IL]


Publication No.: WO2013112942A1  Published: 01/Aug/2013

Title: BIOMARKERS AND COMBINATION THERAPIES USING ONCOLYTIC VIRUS AND IMMUNOMODULATION

Applicant/Assignee: DNA TRIX, INC, MD ANDERSON CANCER CENTER

Application No.: WO2013US23304 (PCT/US2013/23304)   Filing Date: 25/Jan/2013

Abstract:

The invention disclosed herein describes biomarkers useful for prognosis, selection and monitoring of oncolytic virus therapy for patients with various types of cancer. In particular, the present invention provides identification of proteins whose expression patterns are strongly predictive of the outcome of oncolytic virus therapy in a patient with cancer. The present invention provides a method for identifying and selecting cancer patients who are likely to be non-responsive to onocolytic virus therapy. These patients can be co-administered an agent that stimulates a cell-mediated immune response in the patient with the oncolytic virus or can be administered a therapy other than oncolytic virus therapy.

Priority: US201261590441P Applic. Date: 2012-01-25; US201261637191P Applic. Date: 2012-04-23

Inventor: TUFARO FRANK [US]; CONRAD CHARLES [US]; FUEYO-MARGARETO JUAN [US]; LANG FREDERICK [US]; GOMEZ-MANZANO CANDELARIA [US]; YUNG W K ALFRED [US]; HIMBERGER AMY [US]


Publication No.: WO2013113024A1  Published: 01/Aug/2013

Title: LYOPHILIZED PLATELET LYSATES

Applicant/Assignee: JADI CELL LLC

Application No.: WO2013US23490 (PCT/US2013/23490)   Filing Date: 28/Jan/2013

Abstract:

The present disclosure is drawn to compositions and methods of making and using lyophilized platelet lysates. Specifically, a method of preparing a composition suitable for therapeutic use or as a culture medium can comprise steps of concentrating platelets from a platelet source to form a platelet rich portion of the platelet source, and lysing the platelets in the platelet rich portion to form a plurality of lysates. An additional step includes lyophilizing the lysates to form lyophilized platelet lysates in a composition with released concentrations of available growth factors, cytokines, and chemokines. In one example, at 30%, by platelet count, of platelets from a platelet source can be lysed using this process.

Priority: US201213358797 Applic. Date: 2012-01-26

Inventor: PATEL AMIT [US]


Publication No.: WO2013113736A1  Published: 08/Aug/2013

Title: PHARMACEUTICAL COMPOSITION COMPRISING A POLYMERIC CARRIER CARGO COMPLEX AND AN ANTIGEN

Applicant/Assignee: BAYER INNOVATION GMBH, CUREVAC GMBH, ICON GENETICS GMBH

Application No.: WO2013EP51754 (PCT/EP2013/51754)   Filing Date: 30/Jan/2013

Abstract:

The present invention is directed to a pharmaceutical composition including (eg for use as an adjuvant) a polymeric carrier cargo complex, comprising as a carrier a polymeric carrier formed by disulfide-crosslinked cationic components and as a cargo at least one nucleic acid (molecule) and at least one antigen associated with a tumour or cancer disease selected from

an idiotype immunoglobulin (e.g. an idiotype antibody or an idiotype B cell receptor)

or at least one idiotype T cell receptor, or in each case a fragment, variant and/or derivative thereof. The inventive pharmaceutical composition allows for efficient induction of an adaptive immune response directed against the idiotype immunoglobulin or T cell receptor, particularly of a Th1-shiftet immune response. The present invention furthermore provides kits or kits of parts comprising the components of the inventive pharmaceutical composition, as well as the use of the inventive pharmaceutical composition or the inventive kit as a vaccine, particularly in the therapy of a tumour or cancer disease such as lymphoma, particularly B cell or T cell lymphoma.

Priority: EP20120153388 Applic. Date: 2012-01-31

Inventor: BUTLER-RANSOHOFF JOHN-EDWARD [DE]; KALLEN KARL-JOSEF [DE]; KRAMPS THOMAS [DE]; KLIMYUK VICTOR [DE]; JARCZOWSKI FRANZISKA [DE]


Publication No.: WO2013113821A1  Published: 08/Aug/2013

Title: DEVICE-BASED METHODS FOR LOCALISED DELIVERY OF CELL-FREE CARRIERS WITH STRESS-INDUCED CELLULAR FACTORS

Applicant/Assignee: TECHNISCHE UNIVERSITAET MUENCHEN - KLINIKUM RECHTS DER ISAR

Application No.: WO2013EP51910 (PCT/EP2013/51910)   Filing Date: 31/Jan/2013

Abstract:

The present invention relates to an in vitro or ex vivo method of preparing a cell-free composition, said method comprising or consisting of (a) subjecting cells to stress

and (b) collecting factors produced, preferably secreted by said cells when subjected to said stress, thereby obtaining said cell-free composition

wherein said cells are comprised in or form at least one first carrier and said collecting is effected by means of at least one second carrier which second carrier(s) is/are cell-free and concomitantly present with and spatially distinct from said first carrier

and said collecting is effected using a device comprising or consisting of (i) said first carrier(s) which first carriers) comprise(s) said cells or is/are suitable to hold said cells

(ii) said second carrier(s) which is cell-free

and (iii) means of subjecting said cells in said first carrier to stress

wherein first carriers) and second carriers) are positioned such that factors secreted by said cells when subjected to stress are collected in said second carrier (s), wherein means are positioned between said first and second carrier which prevent any cells and/or pathogens present in (any of) said first carrier(s) from entering into said second carrier(s).

Priority: EP20120153769 Applic. Date: 2012-02-03

Inventor: SCHILLING ARNDT [DE]; HADJIPANAYI EKTORAS [DE]; MACHENS HANS-GUENTHER [DE]


Publication No.: WO2013114359A1  Published: 08/Aug/2013

Title: SYSTEM AND METHOD FOR PRODUCING INTERLEUKIN RECEPTOR ANTAGONIST (IRA)

Applicant/Assignee: ESTAR TECHNOLOGIES LTD

Application No.: WO2013IL50076 (PCT/IL2013/50076)   Filing Date: 29/Jan/2013

Abstract:

The present invention relates to a system and method for producing high levels of autologous IL-1RA cytokine, comprising: a blood collection vessel (1), a cover (4), a portion of separation gel (2), an anticoagulant portion(3), a plasma collection syringe comprising a sharp needle (9), a buffy coat collection syringe (11) and an incubation tube with cover(15). The vessel is adapted such that, when containing the whole blood (5), and centrifuged after treatment, yields separation fractions comprising, a first fraction of RBCs sediment(6), a second fraction of said gel(2), a third fraction comprising WBCs, platelets and), and fourth fraction of plasma solution(8).

Priority: US201261592622P Applic. Date: 2012-01-31

Inventor: ESTERON AARON [IL]


Publication No.: WO2013116224A1  Published: 08/Aug/2013

Title: MULTIPOTENT VASCULAR STEM CELLS AND METHODS OF USE THEREOF

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2013US23647 (PCT/US2013/23647)   Filing Date: 29/Jan/2013

Abstract:

A substantially enriched mammalian multipotent vascular stem cell (MVSC) population is provided, as well as compositions comprising the population. Methods are provided for the isolation, purification, and culture of the MVSCs. The MVSCs are useful in various applications, which are also provided.

Priority: US201261594175P Applic. Date: 2012-02-02

Inventor: LI SONG [US]; TANG ZHENYU [US]; WANG AIJUN [US]


Publication No.: WO2013116366A1  Published: 08/Aug/2013

Title: NON-ANTICOAGULANT SULFATED OR SULFONATED POLYSACCHARIDES

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTHCARE S.A

Application No.: WO2013US23892 (PCT/US2013/23892)   Filing Date: 30/Jan/2013

Abstract:

The present invention provides non-anticoagulant sulfated or sulfonated polysaccharides (NASPs), which accelerate the blood clotting process. Also provided are pharmaceutical formulations comprising a NASP of the invention in conjunction with a pharmaceutically acceptable excipient and, in various embodiments, these formulations are unit dosage formulations. The invention provides a NASP formulation, which is orally bioavailable. Also provided are methods for utilizing the compounds and formulations of the invention to promote blood clotting in vivo as therapeutic and prophylactic agents and in vitro as an aid to studies of the blood clotting process.

Priority: US201261592549P Applic. Date: 2012-01-30

Inventor: DOCKAL MICHAEL [AT]; SCHEIFLINGER FRITZ [AT]; KNAPPE SABINE [AT]; TILL SUSANNE [AT]; HAI TON [US]; SANDERS PAUL [US]; DANDE PRASAD [US]; JIANG CONG [US]


Publication No.: WO2013116383A1  Published: 08/Aug/2013

Title: NON-ANTICOAGULANT SULFATED OR SULFONATED SYNTHETIC POLYMERS

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTHCARE S.A

Application No.: WO2013US23919 (PCT/US2013/23919)   Filing Date: 30/Jan/2013

Abstract:

The present invention provides pharmaceutical formulations including a non-anticoagulant, non-saccharide polymer that with at least one sulfate or sulfonate moiety. The pharmaceutical formulations of the invention are of use to improve blood clotting in a subject. Also provided are useful analytical methods utilizing these polymers to query the dynamics of blood clotting in vitro.

Priority: US201261592554P Applic. Date: 2012-01-30

Inventor: DOCKAL MICHAEL [AT]; SCHEIFLINGER FRITZ [AT]; KNAPPE SABINE [AT]; TILL SUSANNE [AT]; HAI TON [US]; SANDERS PAUL [US]


Publication No.: WO2013116482A1  Published: 08/Aug/2013

Title: PROCESS OF AFOD AND AFCC AND MANUFACTURING AND PURIFICATION PROCESSES OF PROTEINS

Applicant/Assignee: SHANGHAI RAAS BLOOD PRODUCTS CO., LTD

Application No.: WO2013US24087 (PCT/US2013/24087)   Filing Date: 31/Jan/2013

Abstract:

Manufacturing and Purification processes of existing discovered and newly discovered proteins, known as KH proteins, in GOOD HEALTHY CELLS. KH CELLS are GOOD HEALTHY CELLS in which the RNA synthesizes good proteins that: 1- Send signal to the DAMAGED, SICK.. AND BAD CELLS that triggers that synthesis of good proteins that transform these cells to become GOOD healthy cells

2- Send signal to the other currently undamaged cells to synthesis of good proteins to protect them from being DAMAGED, INFECTED and PRONE to DNA and other cellular alterations

3- Send signal to the body to produce new cells that are healthy and forbid them from being affected by intra- and extracellular damaging signals

the mechanisms that govern these processes is the KH good healthy cells provide innate good signals that make good proteins to boost the immune system in order to CURE, TO PROTECT, and TO PREVENT diseases, etc.

Priority: US201261648281P Applic. Date: 2012-05-17; US201261593183P Applic. Date: 2012-01-31; US201261593164P Applic. Date: 2012-01-31; US201261692273P Applic. Date: 2012-08-23; US201261710930P Applic. Date: 2012-10-08; US201261593196P Applic. Date: 2012-01-31

Inventor: HOANG KIEU [US]


Publication No.: WO2013116744A1  Published: 08/Aug/2013

Title: BIOMATERIAL FOR ARTICULAR CARTILAGE MAINTENANCE AND TREATMENT OF ARTHRITIS

Applicant/Assignee: CHILDREN'S MEDICAL CENTER CORPORATION, RHODE ISLAND HOSPITAL

Application No.: WO2013US24467 (PCT/US2013/24467)   Filing Date: 01/Feb/2013

Abstract:

The present disclosure provides biomaterials and methods for preventing and minimizing progression of cartilage and/or connective tissue damage. Also provided herein are biomaterials and methods for alleviating and/or reducing the risk for developing arthritis (e.g., osteoarthritis) associated with joint injury and/or joint surgery.

Priority: US201261593415P Applic. Date: 2012-02-01

Inventor: MURRAY MARTHA M [US]; FLEMING BRADEN C [US]


Publication No.: WO2013116791A1  Published: 08/Aug/2013

Title: BIOMATERIALS FOR DELIVERY OF BLOOD EXTRACTS AND METHODS OF USING SAME

Applicant/Assignee: MOSAIC BIOSCIENCES, INC

Application No.: WO2013US24520 (PCT/US2013/24520)   Filing Date: 01/Feb/2013

Abstract:

The disclosure provides biomaterials including scaffolds that include blood products including blood fractions and products including platelets for administration to subjects in need thereof. More specifically, the scaffolds based on step growth polymers are enriched with blood extracts that contain platelet rich plasma (PRP) and/or extracts of platelets. Compositions comprising a biomaterial or precursor thereof and a blood extract are provided, as are methods of making and using the biopolymers or precursors thereof. Kits and articles of manufacture comprising the biopolymers or precursors thereof are also described.

Priority: US201261594116P Applic. Date: 2012-02-02

Inventor: MARINER PETER D [US]; STANTON MARTIN [US]; KAZANTSEV ALEXEI [US]; CALLAN JEANNE [US]


Publication No.: WO2013121416A1  Published: 22/Aug/2013

Title: LONG-ACTING COAGULATION FACTORS AND METHODS OF PRODUCING SAME

Applicant/Assignee: PROLOR BIOTECH INC

Application No.: WO2013IL50107 (PCT/IL2013/50107)   Filing Date: 05/Feb/2013

Abstract:

Polypeptides comprising at least one carboxy-terminal peptide (CTP) of chorionic gonadotrophin attached to the carboxy terminus but not to the amino terminus of a coagulation factor and polynucleotides encoding the same are disclosed. Pharmaceutical compositions comprising the polypeptides and polynucleotides of the invention and methods of using and producing same are also disclosed.

Priority: US201213372540 Applic. Date: 2012-02-14

Inventor: FIMA UDI EYAL [IL]; HART GILI [IL]


Publication No.: WO2013123248A1  Published: 22/Aug/2013

Title: MODULATION OF FACTOR Xa INHIBITOR MEDIATED BLOOD LOSS BY PARTIAL AND TRANSIENT ADMINISTRATION OF ANTIDOTE

Applicant/Assignee: PORTOLA PHARMACEUTICALS, INC

Application No.: WO2013US26212 (PCT/US2013/26212)   Filing Date: 14/Feb/2013

Abstract:

The present disclosure provides unit dose formulations and methods to reduce, stop or prevent bleeding in a patient undergoing anticoagulant therapy with a factor Xa inhibitor. The methods entail at least partial neutralization of the factor Xa inhibitors. The unit dose formulations and methods of the present disclosure can be effective even after actual bleeding has initiated.

Priority: US201261599821P Applic. Date: 2012-02-16; US201261682615P Applic. Date: 2012-08-13; US201261734269P Applic. Date: 2012-12-06; US201361756842P Applic. Date: 2013-01-25; US201361759571P Applic. Date: 2013-02-01

Inventor: HOLLENBACH STANLEY J [US]; LU GENMIN [US]; SINHA UMA [US]


Publication No.: WO2013123591A1  Published: 29/Aug/2013

Title: MULTIMERIZED SINGLE DOMAIN ANTIBODY LIGANDS OF PROTHROMBIN AS INHIBITORS OF BLOOD AND EXTRAVASCULAR COAGULATION

Applicant/Assignee: NATIONAL RESEARCH COUNCIL OF CANADA

Application No.: WO2013CA00175 (PCT/CA2013/00175)   Filing Date: 19/Feb/2013

Abstract:

A multimer of an antibody VHH domain, where the VHH domain has binding affinity to prothrombin, is useful for inhibiting generation of thrombin from prothrombin. Such a multimer is useful in a method of inhibiting thrombin production in a blood stream or in a tissue whereby the multimer is either introduced into the blood stream or into the tissue directly. Inhibiting thrombin production from prothrombin leads to inhibiting blood or extra-vascular coagulation. Thus, such multimers are particularly useful for inhibiting coagulation in applications where blood clotting can lead to fibrin deposition and thrombotic complications, for example, at sites of vascular or tissue injury, such as atherosclerotic lesions and arthritic joints.

Priority: US201261600748P Applic. Date: 2012-02-20

Inventor: NI FENG [CA]; NG ANDY [CA]; WANG PING [CA]; TOLKATCHEV DMITRI [CA]


Publication No.: WO2013124860A1  Published: 29/Aug/2013

Title: POTENT REVITAL FORMULATION

Applicant/Assignee: ZOTA HEALTH CARE LTD

Application No.: WO2013IN00020 (PCT/IN2013/00020)   Filing Date: 10/Jan/2013

Abstract:

This invention is based on a potent revital formulation which comprises two or more active ingredients such as taurine and racemethionine along with essential dietary supplements such as vitamins, iron, minerals, trace elements and pharmaceutically acceptable excipients preferably in oral dosage form.

Priority: IN2012MU00496 Applic. Date: 2012-02-23

Inventor: ZOTA KAMLESH RAJNIKANT [IN]; ZOTA KETAN CHANDULAL [IN]; AGRAWAL SANJAY [IN]; ZOTA MANUKANT CHANDULAL [IN]; ZOTA HIMANSHU MUKTILAL [IN]


Publication No.: WO2013126550A2  Published: 29/Aug/2013

Title: NEW COMPOSITIONS, THE PREPARATION AND USE THEREOF

Applicant/Assignee: KCI LICENSING, INC

Application No.: WO2013US27107 (PCT/US2013/27107)   Filing Date: 21/Feb/2013

Abstract:

The present teachings provide new compositions comprising polycations and polycations, and the preparation and use of these new compositions, !n one aspect, the new compositions are complex coacervates. The compositions described herein can have several desired properties, including, low interfacial tension in water, adjustable cohesive strength, antimicrobial activity, suitability for dissolution at or near physiological pH, the ability to promote cell attachment, biocompatiblility, and/or biodegradability. Thus, in various embodiments, the complex coacervates can be used in water-based applications, for example, in the body.

Priority: US201261601804P Applic. Date: 2012-02-22

Inventor: VAIL NEAL [US]


Publication No.: WO2013126587A1  Published: 29/Aug/2013

Title: SYSTEMS, COMPOSITIONS, AND METHODS FOR TRANSPLANTATION

Applicant/Assignee: CYTONICS CORPORATION

Application No.: WO2013US27159 (PCT/US2013/27159)   Filing Date: 21/Feb/2013

Abstract:

Systems and methods for purification and concentration of autologous alpha-2-macroglobulin (A2M) from whole blood are provided. Also provided are diagnostic methods for identifying sites in the synovial joints, spine, tendons or ligaments for treatment of pain, degeneration, or inflammation with autologous A2M. Methods for utilizing autologous A2M in combination with other autologous treatments (e.g. platelets and other growth factors) are provided in addition to combinations with exogenous drugs or carriers. Also provided is a method of producing recombinant A2M wild type or variants thereof where the bait region was modified to enhance the inhibition characteristics of A2M and/or to prolong the half life of the protein in joints and spine disc or epidural space.

Priority: US201261726815P Applic. Date: 2012-11-15; US201261726840P Applic. Date: 2012-11-15; US201261601434P Applic. Date: 2012-02-21; US201261727433P Applic. Date: 2012-11-16; US201261740218P Applic. Date: 2012-12-20

Inventor: HANNA LEWIS [US]; LAUGHLIN JOHN DAVID [US]; BROWNING SHAWN ROBERT [US]


Publication No.: WO2013126617A1  Published: 29/Aug/2013

Title: BOUVARDIN DERIVATIVES AND THERAPEUTIC USES THEREOF

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF COLORADO, A BODYCORPORATE, SUVICA, INC

Application No.: WO2013US27200 (PCT/US2013/27200)   Filing Date: 21/Feb/2013

Abstract:

The present invention is directed at bouvardin analogs arid related compounds for the treatment of disorders including cancer. Provided herein are bouvardin analogs and related compounds, pharmaceutical compositions and kits comprising at least one bouvardin analog or related compound, and methods for treating disorders including cancer. In some aspects the compounds inhibit translation elongation at the ribosome. The compounds are used in combination with radiation therapy or with known chemotherapeutic compositions.

Priority: US201261702706P Applic. Date: 2012-09-18; US201261601981P Applic. Date: 2012-02-22

Inventor: SU TIN TIN [US]; GLADSTONE MARA N [US]; ZHANG GAN [US]; SAMMAKIA TAREK [US]


Publication No.: WO2013130150A2  Published: 06/Sep/2013

Title: METALLOPORPHYRIN NEUROLOGICAL TREATMENTS

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF COLORADO, A BODYCORPORATE

Application No.: WO2012US67633 (PCT/US2012/67633)   Filing Date: 03/Dec/2012

Abstract:

Methods and compositions for treating a subject suffering from exposure to a chemical threat agent are disclosed.

Priority: US201161566530P Applic. Date: 2011-12-02

Inventor: PATEL MANISHA [US]


Publication No.: WO2013130411A1  Published: 06/Sep/2013

Title: SALTS OF POTASSIUM ATP CHANNEL OPENERS AND USES THEREOF

Applicant/Assignee: ESSENTIALIS, INC

Application No.: WO2013US27676 (PCT/US2013/27676)   Filing Date: 25/Feb/2013

Abstract:

Provided are immediate or prolonged administration of certain salts of KATP channel openers such as diazoxide to a subject to achieve novel pharmacodynamic, pharmacokinetic, therapeutic, physiological, metabolic and compositional outcomes in the treatment of diseases or conditions involving KATP channels. Also provided are pharmaceutical formulations, methods of administration and dosing of the salts that achieve these outcomes and reduce the incidence of adverse effects in treated individuals. Further provided are method of co-administering the salts with other drugs to treat diseases of humans and animals.

Priority: US201261603923P Applic. Date: 2012-02-27

Inventor: COWEN NEIL M [US]; PASTERNARK RICHARD C [US]


Publication No.: WO2013130499A1  Published: 06/Sep/2013

Title: COMPOSITIONS AND METHODS FOR CXCR4 SIGNALING AND UMBILICAL CORD BLOOD STEM CELL ENGRAFTMENT

Applicant/Assignee: UNIVERSITY OF VIRGINIA PATENT FOUNDATION

Application No.: WO2013US27876 (PCT/US2013/27876)   Filing Date: 27/Feb/2013

Abstract:

The present invention provides for enhancing engraftment by co-infusing at least two partially HLA matched umbilical cord blood ("UCB") units. The invention further provides for positive C3a mediated priming on responsiveness to doses of SDF-1 and C3a induced incorporation of CXCR4 in membranes in HSC and progenitors. The invention further provides for enhancing the homing of UCB HSC and progenitors via the SDF-1 /CXCR4 pathway and that C3a and LL-37 are useful for this method. It is also disclosed herein that fragments of C3a (e.g., des-Arg) are effective in the methods of the invention, including enhancing homing of HSPCs to BM. The invention further encompasses the disclosure herein of NFAT1 regulation post-transcriptionally by both mir-184 and IFN-gamma. The present invention further provides for measuring and using differences between UCB and adult CD4+/45RA+ T-cells as a means of defining strategies to enhance optimal allogeneic stem cell transplantation outcomes. The present invention further provides methods for maintaining IL-2 production in the absence of NFAT1 normal protein levels.

Priority: US201261605035P Applic. Date: 2012-02-29

Inventor: LAUGHLIN MARY J [US]; RATAJCZAK MARIUSZ Z [US]; BRUNSTEIN CLAUDIO [US]


Publication No.: WO2013134464A1  Published: 12/Sep/2013

Title: TISSUE CONSTRUCTS AND USES THEREOF

Applicant/Assignee: CHILDREN'S MEDICAL CENTER CORPORATION

Application No.: WO2013US29517 (PCT/US2013/29517)   Filing Date: 07/Mar/2013

Abstract:

Artificial tissue constructs (TCs), methods of making the TCs, uses thereof, and kits comprising the TCs are provided. TCs are useful for vaccine evaluation for human adult, human non-newborn, and newborns.

Priority: US201261607796P Applic. Date: 2012-03-07; US201261617874P Applic. Date: 2012-03-30

Inventor: SANCHEZ-SCHMITZ GUZMAN [US]; LEVY OFER [US]; STEVENS CHAD [US]


Publication No.: WO2013134649A1  Published: 12/Sep/2013

Title: BIOMARKERS FOR CANCER STEM CELLS AND RELATED METHODS OF USE

Applicant/Assignee: VERASTEM, INC

Application No.: WO2013US29895 (PCT/US2013/29895)   Filing Date: 08/Mar/2013

Abstract:

Novel methods of classifying subjects as candidates for treatment with a cancer associated mesenchymal cell, tumor initiating cancer cell, or cancer stem cell inhibitor treatment and subsequent administration of the cancer associated mesenchymal cell, tumor initiating cancer cell, or cancer stem cell inhibitor are disclosed within.

Priority: US201261609031P Applic. Date: 2012-03-09

Inventor: DERR ALAN G [US]; WEAVER DAVID T [US]; SHAPIRO IRINA [US]; PATERSON DANIEL W [US]; PACHTER JONATHAN A [US]


Publication No.: WO2013135800A1  Published: 19/Sep/2013

Title: CATIONIC LIPOSOMAL DRUG DELIVERY SYSTEM FOR SPECIFIC TARGETING OF HUMAN CD14+ MONOCYTES IN WHOLE BLOOD

Applicant/Assignee: BIONEER A/S, DTU NANOTECH

Application No.: WO2013EP55207 (PCT/EP2013/55207)   Filing Date: 14/Mar/2013

Abstract:

This invention concerns a liposome comprising lipids and at least one active ingredient, wherein at least one of the lipids is a cationic lipid

said liposome exhibiting a net positive charge at physiological conditions at which said liposome preferentially adheres to monocytes in freshly drawn blood when compared to adherence to granulocytes, T-lymphocytes, B- lymphocytes and/or NK cells in freshly drawn blood, to a lipid-based pharmaceutical composition comprising said liposomes and their use in monocytic associated prophylaxis, treatment or amelioration of a condition such as cancer, an infectious disease, an inflammatory disease, an autoimmune disease or allergy.

Priority: EP20120159497 Applic. Date: 2012-03-14; US201261610801P Applic. Date: 2012-03-14

Inventor: JENSEN SIMON SKJOEDE [DK]; ANDRESEN THOMAS LARS [DK]; HENRIKSEN JONAS ROSAGER [DK]; JOHANSEN PIA THERMANN [DK]


Publication No.: WO2013136184A2  Published: 19/Sep/2013

Title: BIOENGINEERED ALLOGENEIC BLOOD VESSEL

Applicant/Assignee: NOVAHEP AB

Application No.: WO2013IB00873 (PCT/IB2013/00873)   Filing Date: 01/Mar/2013

Abstract:

The present invention relates to methods for recellurization of blood vessels. This method is particularly useful for producing an allogeneic vein, wherein a donor vein is decellularized and then recellularized using whole blood or bone marrow stem cells. The allogeneic vein produced by the methods disclosed herein are particularly advantageous for implantation or transplantation into patients with vascular diseases.

Priority: US201261611810P Applic. Date: 2012-03-16

Inventor: SUMITRAN-HOLGERSSON SUCHITRA [SE]


Publication No.: WO2013138240A1  Published: 19/Sep/2013

Title: GLYCOSAMINOGLYCAN AND SYNTHETIC POLYMER MATERIALS FOR BLOOD-CONTACTING APPLICATIONS

Applicant/Assignee: COLORADO STATE UNIVERSITY RESEARCH FOUNDATION

Application No.: WO2013US30230 (PCT/US2013/30230)   Filing Date: 11/Mar/2013

Abstract:

Provided herein is a composite, comprising: a polymer host selected from the group consisting of low-density polyethylene (LDPE), linear low-density polyethylene (LLDPE), polyethylene terephthalate (PET), polytetrafluoroethylene (PTFE), and polypropylene (PP), polyurethane, polycaprolactone (PCL), polydimethylsiloxane (PDMS), polymethylmethacrylate (PMMA), and polyoxymethylene (POM)

and a guest molecule comprising hyaluronic acid

wherein the guest molecule is disposed within the polymer host, and wherein the guest molecule is covalently bonded to at least one other guest molecule. Also provided herein are methods for forming the composite, and blood-contracting devices made from the composite, such as heart valves and vascular grafts.

Priority: US201261609818P Applic. Date: 2012-03-12

Inventor: JAMES SUSAN P [US]; DEAN IV HAROLD [US]; DASI LAKSHMI PRASAD [US]; FORLEO MARCIO H [US]; POPAT KETUL C [US]; LEWIS NICOLE R [US]


Publication No.: WO2013138696A1  Published: 19/Sep/2013

Title: ZIRCONIUM-89 COMPLEXES, METHODS OF LABELING CELLS, LABELED CELLS, KITS, AND METHODS OF USE THEREOF

Applicant/Assignee: THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVIC

Application No.: WO2013US31944 (PCT/US2013/31944)   Filing Date: 15/Mar/2013

Abstract:

Described herein are 89Zr PET imaging complexes, methods of labeling biological cells with 89Zr, and cells labeled with 89Zr. Also described are kits for labeling of cells with 89Zr. The labeled cells can be administered to a subject and then imaged using PET imaging.

Priority: US201261611964P Applic. Date: 2012-03-16

Inventor: ARAS OMER [US]; CHOYKE PETER L [US]; FRANK JOSEPH ALAN [US]; PANTIN JEREMY MARK [US]; CHILDS WILLIAM RICHARD [US]; SATO NORIKO [US]; HOYT JR ROBERT FRANKLIN [US]


Publication No.: WO2013141965A1  Published: 26/Sep/2013

Title: TFPI INHIBITORS AND METHODS OF USE

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTHCARE SA

Application No.: WO2013US24167 (PCT/US2013/24167)   Filing Date: 31/Jan/2013

Abstract:

The invention provides peptides that bind Tissue Factor Pathway Inhibitor (TFPI), including TFPI-inhibitory peptides, and compositions thereof. Peptide complexes also are provided. The peptides may be used to inhibit a TFPI, enhance thrombin formation in a clotting factor-deficient subject, increase blood clot formation in a subject, treat a blood coagulation disorder in a subject, purify TFPI, and identify a TFPI-binding compound.

Priority: US201261613865P Applic. Date: 2012-03-21

Inventor: DOCKAL MICHAEL [AT]; HARTMANN RUDOLF [AT]; SCHEIFLINGER FRIEDRICH [AT]; OSTERKAMP FRANK [DE]; POLAKOWSKI THOMAS [DE]; REINEKE ULRICH [DE]


Publication No.: WO2013142135A1  Published: 26/Sep/2013

Title: METHOD OF ENHANCING EFFICACY OF BLOOD TRANSFUSIONS

Applicant/Assignee: ALBERT EINSTEIN COLLEGE OF MEDICINE OF YESHIVA UNIVERSITY, THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2013US30355 (PCT/US2013/30355)   Filing Date: 12/Mar/2013

Abstract:

A method of improving the efficacy of a blood transfusion into a subject is provided comprising administering a composition comprising an EAF PEGylated-blood protein into the subject, prior to, during, or subsequent to the blood transfusion.

Priority: US201261613105P Applic. Date: 2012-03-20

Inventor: ACHARYA SEETHARAMA A [US]; INTAGLIETTA MARCOS [US]


Publication No.: WO2013142153A2  Published: 26/Sep/2013

Title: APTAMERS TO TISSUE FACTOR PATHWAY INHIBITOR AND THEIR USE AS BLEEDING DISORDER THERAPEUTICS

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTCARE S.A

Application No.: WO2013US30576 (PCT/US2013/30576)   Filing Date: 12/Mar/2013

Abstract:

The present invention provides compositions and methods for modulating TFPI protein plasma concentration and TFPI protein function. Such modulation can be used to treat blood disorders such as bleeding disorders and clotting disorders.

Priority: US201261614438P Applic. Date: 2012-03-22; US201261667823P Applic. Date: 2012-07-03

Inventor: DOCKAL MICHAEL [AT]; SCHEIFLINGER FRIEDRICH [AT]


Publication No.: WO2013142328A1  Published: 26/Sep/2013

Title: SMALL MOLECULE ANTAGONISTS OF PF4 CONTAINING ULTRA LARGE COMPLEXES

Applicant/Assignee: THE TRUSTEES OF THE UNIVERSITY OF PENSYLVANIA

Application No.: WO2013US32092 (PCT/US2013/32092)   Filing Date: 15/Mar/2013

Abstract:

Methods for preventing formation of or disrupting PF4 tetramers are provided. The compounds useful in such methods bind to a PF4 tetramer, dimer, or monomer. The compounds are also useful for preventing formation of or disrupting ultra-large complexes containing a PF4 tetramer and a glycosaminoglycan, and thus have utility toward preventing or treating medical conditions related to the formation of PF4 tetramers, such as HITT and atherosclerosis and toward correcting a platelet imbalance, preventing a decrease in platelet production and increasing high density lipoproteins in a subject. Also provided are compositions and kits containing these compounds and optional medications which cause the formation of PF4 tetramers, and/or medications which disrupt PF4 tetramers. [Formula I]

Priority: US201261614709P Applic. Date: 2012-03-23

Inventor: SACHAIS BRUCE [US]; RUX JOHN [US]


Publication No.: WO2013142374A1  Published: 26/Sep/2013

Title: COMPOSITIONS AND USES OF ANTIMICROBIAL MATERIALS WITH TISSUE-COMPATIBLE PROPERTIES

Applicant/Assignee: AMIROBE, INC

Application No.: WO2013US32535 (PCT/US2013/32535)   Filing Date: 15/Mar/2013

Abstract:

Compositions comprising a mixture of an antimicrobial cationic polypeptide and a second pharmaceutically-acceptable polymer are disclosed, as well as methods and uses thereof for the treatment and prevention of infections that occur when our natural barriers of defense are broken.

Priority: US201261625760P Applic. Date: 2012-04-18; US201261625757P Applic. Date: 2012-04-18; US201261615150P Applic. Date: 2012-03-23; US201261716242P Applic. Date: 2012-10-19

Inventor: BEVILACQUA MICHAEL P [US]; BENITEZ DIEGO [US]; HANSON JARROD A [US]


Publication No.: WO2013143548A1  Published: 03/Oct/2013

Title: COMPOUNDS CAPABLE OF MODULATING/PRESERVING ENDOTHELIAL INTEGRITY FOR USE IN PREVENTION OR TREATMENT OF ACUTE TRAUMATIC COAGULOPATHY AND RESUSCITATED CARDIAC ARREST

Applicant/Assignee: RIGSHOSPITALET

Application No.: WO2013DK50090 (PCT/DK2013/50090)   Filing Date: 26/Mar/2013

Abstract:

The present invention relates to novel uses of compounds that protect the endothelium, particularly prostacyclin and variants and derivatives thereof in the treatment or prevention of acute traumatic coagulopathy (ATC) and of patients resuscitating from cardiac arrest. The invention also relates to a method of identifying individuals at risk of developing ATC.

Priority: DK20120070163 Applic. Date: 2012-03-30

Inventor: JOHANSSON PAER [SE]; OSTROWSKI SISSE RYE [DK]


Publication No.: WO2013148136A1  Published: 03/Oct/2013

Title: OMEGA-3 FATTY ACID ESTER COMPOSITIONS

Applicant/Assignee: SANCILIO & COMPANY, INC

Application No.: WO2013US30211 (PCT/US2013/30211)   Filing Date: 11/Mar/2013

Abstract:

Described herein are compositions comprising at least one Omega-3 fatty acid ester and at least one surface active agent

wherein the compositions form micelles when in contact with an aqueous medium. Also provided is a method of administering to a subject a composition comprising at least one Omega-3 fatty acid ester and at least one surface active agent, wherein the at least one Omega-3 fatty acid ester forms micelles when in contact with an aqueous medium, and the bioavailability of the at least one Omega-3 fatty acid ester is substantially independent of a food effect. Said compositions are useful for treating cardiovascular conditions or disorders in a subject and for reducing side effects associated with the ingestion of Omega-3 fatty acid esters. Described are also various dosage forms for administering said compositions and use of said compositions in functional foods. Provided herein are also kits with instructions on how to administer said compositions.

Priority: US201261618161P Applic. Date: 2012-03-30

Inventor: SANCILIO FREDERICK [US]; PERSICANER PETER [US]; CACACE JANICE [US]; DAHIM MOHAND [US]


Publication No.: WO2013148232A1  Published: 03/Oct/2013

Title: METHODS OF PROGNOSING, DIAGNOSING AND TREATING IDIOPATHIC PULMONARY FIBROSIS

Applicant/Assignee: GENENTECH, INC, F. HOFFMANN-LA ROCHE AG

Application No.: WO2013US31178 (PCT/US2013/31178)   Filing Date: 14/Mar/2013

Abstract:

Compositions, kits and methods for assessing the prognosis of idiopathic pulmonary fibrosis in patients are provided. In addition, compositions, kits and methods for diagnosing subtypes of idiopathic pulmonary fibrosis are provided. Also provided are methods for treating idiopathic pulmonary fibrosis.

Priority: US201261616394P Applic. Date: 2012-03-27; US201261707411P Applic. Date: 2012-09-28

Inventor: ABBAS ALEXANDER R [US]; ARRON JOSEPH R [US]; CHANDRIANI SANJAY [US]; JIA GUIQUAN [US]; LEWIN-KOH NICHOLAS J I [US]; DEPIANTO DARYLE [US]


Publication No.: WO2013148366A1  Published: 03/Oct/2013

Title: COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF MAST CELL-INDUCED VASCULAR LEAKAGE

Applicant/Assignee: DUKE UNVERSITY

Application No.: WO2013US32553 (PCT/US2013/32553)   Filing Date: 15/Mar/2013

Abstract:

Disclosed herein are methods of diagnosing and treating infectious disease characterized by a pathology that involves hemorrhaging or pathological vascular leakage.

Priority: US201261616062P Applic. Date: 2012-03-27

Inventor: ABRAHAM SOMAN N [US]; ST JOHN ASHLEY L [US]


Publication No.: WO2013148478A1  Published: 03/Oct/2013

Title: THROMBIN INHIBITORS

Applicant/Assignee: MERCK SHARP & DOHME CORP

Application No.: WO2013US33399 (PCT/US2013/33399)   Filing Date: 22/Mar/2013

Abstract:

Compounds of the invention are useful in inhibiting thrombin and associated thrombotic occlusions having the following structure: (I) or a pharmaceutically acceptable salt thereof, wherein Q is CH2, NR4, O, S, S(O) or S(O2), wherein R4 is H, C1-6 alkyl, aryl, or C3-8 cycloalkyl

R1 is a heterocycle or -(CR5R6)1-2NH2, wherein R5 and R6, each time in which they occur, are independently H, C1-6 alkyl, -CH2F,-CHF2, CF3 or -CH2OH

R2 is OH, NH2 or NHSO2CH3

and R3 is C1-6 alkyl.

Priority: US201261616647P Applic. Date: 2012-03-28

Inventor: BLIZZARD TIMOTHY ALLEN [US]; BIFTU TESFAYE [US]


Publication No.: WO2013149219A2  Published: 03/Oct/2013

Title: FULLY HUMAN ANTIBODIES THAT BIND TO VEGFR2

Applicant/Assignee: SORRENTO THERAPEUTICS INC

Application No.: WO2013US34732 (PCT/US2013/34732)   Filing Date: 30/Mar/2013

Abstract:

There is disclosed compositions and methods relating to anti-VEGFR2 antibodies. More specifically, there is disclosed fully human antibodies that bind VEGFR2, VEGFR2- binding fragments and derivatives of such antibodies, and VEGFR2-binding polypeptides comprising such fragments. Further still, there is disclosed antibody fragments and derivatives and polypeptides, and methods of using such antibodies, antibody fragments and derivatives and polypeptides, including methods of treating or diagnosing subjects having various cancers.

Priority: US201261618658P Applic. Date: 2012-03-30

Inventor: GASTWIRT RANDY [US]; ZHOU HEYUE [US]; GRAY JOHN DIXON [US]; LU GUODI [US]


Publication No.: WO2013151719A2  Published: 10/Oct/2013

Title: FLUORINATED OXAZOLIDINONE DERIVATIVES

Applicant/Assignee: SCIFLUOR LIFE SCIENCES, LLC

Application No.: WO2013US31405 (PCT/US2013/31405)   Filing Date: 14/Mar/2013

Abstract:

The invention relates to fluorinated compounds and their use in the field of blood coagulation. Novel fluorinated oxazolidinone derivatives of rivaroxaban and pharmaceutically acceptable salts or solvates thereof and their use as medicinally active compounds for the treatment and prevention of disorders are described.

Priority: US201261697695P Applic. Date: 2012-09-06; US201261620623P Applic. Date: 2012-04-05

Inventor: DUGGAN MARK E [US]; FURUYA TAKERU [US]; EDWARDS D SCOTT [US]


Publication No.: WO2013152024A1  Published: 10/Oct/2013

Title: HUMANIZED AND CHIMERIC ANTI-FACTOR C3 ANTIBODIES AND USES THEREOF

Applicant/Assignee: NOVELMED THERAPEUTICS, INC

Application No.: WO2013US34990 (PCT/US2013/34990)   Filing Date: 02/Apr/2013

Abstract:

A method of inhibiting complement activation mediated by C3b inhibitors in a subject includes administering a C3b inhibitor to the subject to inhibit at least one of C3b binding to factors B and properdin, inhibit C3 cleavage, inhibit the activation of neutrophils, monocytes, platelets, and endothelium

or inhibit the formation of C3a, C5a, and MAC.

Priority: US201261619860P Applic. Date: 2012-04-03

Inventor: BANSAL REKHA [US]


Publication No.: WO2013156488A2  Published: 24/Oct/2013

Title: OPTIMISED SUBCUTANEOUS THERAPEUTIC AGENTS

Applicant/Assignee: LEVERTON LICENCE HOLDINGS LIMITED

Application No.: WO2013EP57928 (PCT/EP2013/57928)   Filing Date: 16/Apr/2013

Abstract:

Methods and dosage formulations are provided for subcutaneous administration in which therapeutic agents are modified to increase the hydrophilicity and molecular dimensions in relation to the native state of the therapeutic agent, in which the Cmax:Caverage ratio is lower than the Cmax:Caverage ratio of the agent when delivered intravenously.

Priority: GB20120006628 Applic. Date: 2012-04-16; GB20120013712 Applic. Date: 2012-08-01; GB20120014985 Applic. Date: 2012-08-22

Inventor: HENRY WILLIAM [GB]; WOLF-GARRAWAY RICHARD [GB]; MAYO JOHN CHARLES [GB]; EARL MICHAEL JAMES [GB]


Publication No.: WO2013158748A1  Published: 24/Oct/2013

Title: HUMAN ANTIBODIES AND SPECIFIC BINDING SEQUENCES THEREOF FOR USE IN STROKE AND ISCHEMIA OR ISCHEMIC CONDITIONS

Applicant/Assignee: MAYO FOUNDATION FOR MEDICAL EDUCATION AND RESEARCH

Application No.: WO2013US36947 (PCT/US2013/36947)   Filing Date: 17/Apr/2013

Abstract:

Specific binding members, particularly human antibodies, particularly recombinant antibodies, and fragments thereof, which are capable of binding to and recognizing neurons in the CNS and eliciting responses in CNS neurons are provided. The antibodies are useful in the diagnosis and treatment of conditions associated with nerve damage, injury or degeneration and neurodegenerative disease, and in particular in the treatment or alleviation of stroke or cerebral ischemia. The antibodies, variable regions or CDR domain sequences. thereof, and fragments thereof of the invention may also be used in therapy in combination with chemotherapeutics, immune modulators, or neuroactive agents and/or with other antibodies or fragments thereof. The antibodies or active fragments thereof may be used in therapy for stroke or cerebral ischemia alone or in combination with thrombolytics such as TPA. Antibodies are exemplified by the antibodies lgM12 and lgM42 whose sequences are provided herein.

Priority: US201261625628P Applic. Date: 2012-04-17

Inventor: RODRIGUEZ MOSES [US]; WARRINGTON ARTHUR E [US]; PEASE LARRY R [US]


Publication No.: WO2013159190A1  Published: 31/Oct/2013

Title: DIETARY FIBER COMPOSITIONS FOR THE TREATMENT OF METABOLIC DISEASE

Applicant/Assignee: INOVOBIOLOGIC, INC

Application No.: WO2013CA00392 (PCT/CA2013/00392)   Filing Date: 22/Apr/2013

Abstract:

Dietary fibre compositions composed of 48-90% w/w glucomannan, 5-20% w/w xanthan gum and 5-30% w/w alginate in combination with metformin, sitagliptin or a mixture thereof for the treatment of metabolic disease are disclosed.

Priority: US201261638147P Applic. Date: 2012-04-25

Inventor: GAHLER ROLAND JACQUES [CA]; LYON MICHAEL ROBERT [CA]; WOOD SIMON [CA]


Publication No.: WO2013160855A1  Published: 31/Oct/2013

Title: COMPOSITION AND METHOD OF STEM CELLS FOR PRESERVERVATION OF CARDIAC TISSUE

Applicant/Assignee: CRIOESTAMINAL, SAUDE E TECNOLOGIA, SA

Application No.: WO2013IB53250 (PCT/IB2013/53250)   Filing Date: 24/Apr/2013

Abstract:

The present disclosure describes a method and composition for enhancing the survival of hematopoietic stem cells, preferably CD34+ derived from human umbilical cord or peripheral blood, in hypoxic and serum-deprived conditions by cultivating the cells in medium containing lysophosphatidic acid, preferably further comprising a gel, namely a biomimetic gel. The method and composition may be used in medicine or cosmetic application, in particular, in treatment of cardiac tissue and/or cardiac diseases, and /or in the treatment of wound healing namely diabetic wound healing

Priority: PT20120106267 Applic. Date: 2012-04-24

Inventor: DA SILVA FERREIRA LINO [PT]; FIDALGO DOS SANTOS SILVA CARVALHO ISABEL MARIA [PT]


Publication No.: WO2013163344A1  Published: 31/Oct/2013

Title: 2.2-DIFLUOROPROPIONAMIDE DERIVATIVES OF BARDOXOLONE METHYL, POLYMORPHIC FORMS AND METHODS OF USE THEREOF

Applicant/Assignee: REATA PHARMACEUTICALS, INC

Application No.: WO2013US38064 (PCT/US2013/38064)   Filing Date: 24/Apr/2013

Abstract:

The present invention relates generally to the compound: N-((4aS,6aR,6bS,8aR,12aS,14aR,14bS)-1 1-cyano-2,2,6a,6b,9,9,12a-heptamethyl-10,14-dioxo-1,2,3,4,4a,5,6,6a,6b,7,8,8a,9,10,12a,14,14a,14b- octadecahydropicen-4a-yl)-2,2-difluoropropanamide, polymorphic forms thereof, methods for preparation and use thereof, pharmaceutical compositions thereof, and kits and articles of manufacture thereof.

Priority: US201361775288P Applic. Date: 2013-03-08; US201261687669P Applic. Date: 2012-04-27; US201361780444P Applic. Date: 2013-03-13

Inventor: ANDERSON ERIC [US]; DECKER ANDREA [CH]; LIU XIAOFENG [US]


Publication No.: WO2013163479A1  Published: 31/Oct/2013

Title: METHODS AND COMPOSITIONS FOR TREATING AND DIAGNOSING ACUTE MYOCARDIAL INFARCTION

Applicant/Assignee: GENERAL ISTRAZIVANJA D.O.O

Application No.: WO2013US38294 (PCT/US2013/38294)   Filing Date: 25/Apr/2013

Abstract:

Compositions and methods for treating and diagnosing acute myocardial infarction are described. The invention also provides a method of treating an individual to prevent or inhibit damage to myocardial tissue from an acute myocardial infarction comprising administering to the individual an antibody to BMP-1-3, or an antibody to BMP-1-4, or a combination of an antibody BMP-1-3 and an antibody to BMP-1-4 prior to AMI.

Priority: US201261638373P Applic. Date: 2012-04-25; US201261638424P Applic. Date: 2012-04-25

Inventor: VUKICEVIC SLOBODAN [HR]; GRGUREVIC LOVORKA [HR]; DUMIC-CULE IVO [HR]


Publication No.: WO2013165304A1  Published: 07/Nov/2013

Title: METHODS FOR MODIFICATION OF TISSUES

Applicant/Assignee: YO PROTEINS AB

Application No.: WO2013SE50472 (PCT/SE2013/50472)   Filing Date: 26/Apr/2013

Abstract:

The present invention relates to methods for modification of mechanical properties or a shape of a mammalian tissue, excluding scar, blood clot, fat

comprising a step of contacting said tissue with an isolated eukaryotic endopeptidase in an amount sufficient to cause a modification of mechanical properties of said tissue or its shape, but insufficient to cause degradation of said tissue's into incohesive parts, and to the use of eukaryotic endopeptidases for use in methods for treatment of the mammalian body.

Priority: US201261640008P Applic. Date: 2012-04-30

Inventor: ROZKOV ALEKSEI [SE]


Publication No.: WO2013166177A2  Published: 07/Nov/2013

Title: PTEROSTILBENE AND CURCUMIN COMBINATION FOR TREATMENT OF OXIDATIVE STRESS AND INFLAMMATION

Applicant/Assignee: CHROMADEX INC

Application No.: WO2013US39105 (PCT/US2013/39105)   Filing Date: 01/May/2013

Abstract:

A pharmaceutical composition is provided comprising a therapeutically effective amount of pterostilbene, a therapeutically effective amount of curcumin, and a pharmaceutically acceptable carrier. The embodiments of the pharmaceutical compositions can have lipid lowering properties, or alternatively can have properties that can treat oxidative stress, by decreasing inflammation or inflammatory processes contributing to digestive disorders or cancer. A method of treating an individual for an inflammatory disorder is provided, comprising administering to the individual in need of such treatment a pharmaceutical composition including a therapeutically effective amount of pterostilbene, a therapeutically effective amount of a curcumin, and a pharmaceutically acceptable carrier. The combination containing pterostilbene and curcumin is effective for treatment or prevention of oxidative stress, treatment of digestive disorders including inflammatory bowel disease, and/or to reduce or inhibit inflammation, in both animals and in humans.

Priority: US201261640903P Applic. Date: 2012-05-01; US201313874220 Applic. Date: 2013-04-30

Inventor: BARTOS JEREMY [US]


Publication No.: WO2013166378A1  Published: 07/Nov/2013

Title: HYDRODYNAMIC METHODS FOR DELIVERING FLUIDS TO KIDNEY TISSUES AND RELATED MATERIALS AND METHODS

Applicant/Assignee: INDIANA UNIVERSITY RESEARCH AND TECHNOLOGY CORPORATION

Application No.: WO2013US39454 (PCT/US2013/39454)   Filing Date: 03/May/2013

Abstract:

The present invention provides methods and materials useful delivering liquids, including liquids comprising nucleic acid molecules into cells. In particular, the present invention provides methods for delivering saline solution, exogenous compositions, and isolated vectors to kidney cells, using the renal vein as a guide and under hydrodynamic pressure. The delivery methods and materials herein are useful to research, prognose, ameliorate symptoms of kidney injury, and treat kidney pathologies.

Priority: US201261642203P Applic. Date: 2012-05-03; US201261680757P Applic. Date: 2012-08-08; US201361770848P Applic. Date: 2013-02-28

Inventor: BACALLAO ROBERT [US]; ATKINSON SIMON [US]; RHODES GEORGE [US]; CORRIDON PETER [US]


Publication No.: WO2013168025A1  Published: 14/Nov/2013

Title: COMPOSITIONS AND METHODS FOR TREATMENT OF BLOOD CLOTTING DISORDERS

Applicant/Assignee:

Application No.: WO2013IB52329 (PCT/IB2013/52329)   Filing Date: 24/Mar/2013

Abstract:

Disclosed are compounds of benzimidazole derivatives, pharmaceutical acceptable salts, as well as polymorphs, solvates, enantiomers, stereoisomers and hydrates thereof. Provided are also pharmaceutical compositions comprising an effective amount of the above compounds for treating or preventing blood clotting disorders, which may be formulated for oral, buccal, rectal, topical, transdermal, transmucosal, intravenous, parenteral administration, syrup, or injection. Such compositions may be used for the treatment of strokes in those with atrial fibrillation due to causes other than heart valve disease, and at least one additional risk factor for stroke (congestive heart failure, hypertension, age, diabetes, and prior stroke), and to prevent the formation of blood clots in the veins in adults operated to replace a hip or knee.

Priority: IN2012CH01809 Applic. Date: 2012-05-08

Inventor: KANDULA MAHESH [IN]


Publication No.: WO2013168108A2  Published: 14/Nov/2013

Title: CHEMOKINE RECEPTOR BINDING POLYPEPTIDES

Applicant/Assignee: NOVARTIS AG

Application No.: WO2013IB53711 (PCT/IB2013/53711)   Filing Date: 08/May/2013

Abstract:

The present invention relates to polypeptides directed against or specifically binding to chemokine receptor CXCR2 and in particular to polypeptides capable of modulating signal transduction from CXCR2. The invention also relates to nucleic acids, vectors and host cells capable of expressing the polypeptides of the invention, pharmaceutical compositions comprising the polypeptides and uses of said polypeptides and compositions for treatment of diseases involving aberrant functioning of CXCR2.

Priority: US201261644582P Applic. Date: 2012-05-09

Inventor: BROWN ZARIN [GB]; BRADLEY MICHELLE [GB]; CHARLTON STEVEN JOHN [GB]; VAN HEEKE GINO ANSELMUS [GB]; CROMIE KAREN [BE]; DOMBRECHT BRUNO [BE]; STEFFENSEN SOREN [BE]; BAUMEISTER JUDITH [BE]; BOUCHE MARIE-PAULE [BE]; BOUTTON CARLO [BE]; BUYSE MARIE-ANGE [BE]; SNOECK VEERLE [BE]; STAELENS STEPHANIE [BE]


Publication No.: WO2013169355A1  Published: 14/Nov/2013

Title: TREATMENT OF MYELOSUPPRESSION

Applicant/Assignee: PARINGENIX, INC

Application No.: WO2013US31053 (PCT/US2013/31053)   Filing Date: 13/Mar/2013

Abstract:

Methods are presented for attenuating myelosuppressive side effects of treatment regimens, promoting thrombopoiesis and neutrophil production, and increasing efficacy of treatment regimens, by administering PF4-interacting heparinoids.

Priority: US201261644623P Applic. Date: 2012-05-09; US201261644556P Applic. Date: 2012-05-09; US201261648043P Applic. Date: 2012-05-16; US201261653362P Applic. Date: 2012-05-30; US201261664611P Applic. Date: 2012-06-26; US201261668709P Applic. Date: 2012-07-06; US201261678053P Applic. Date: 2012-07-31; US201261702207P Applic. Date: 2012-09-17; US201261724836P Applic. Date: 2012-11-09

Inventor: MARCUS STEPHEN [US]


Publication No.: WO2013169741A1  Published: 14/Nov/2013

Title: AGENTS AND DEVICES FOR AFFECTING NERVE FUNCTION

Applicant/Assignee:

Application No.: WO2013US39904 (PCT/US2013/39904)   Filing Date: 07/May/2013

Abstract:

Agents and devices for affecting nerve function are described. In some variations, a combination of agents, e.g., a cardiac glycoside, an ACE inhibitor, and an NSAID are delivered to affect nerve function. The agent may be delivered locally in a site-specific manner to a targeted nerve or portion of a nerve. For example, the agent may be delivered locally to the renal nerves to impair their function and treat hypertension. One variation of a delivery device includes one or more needle housings supported by a balloon. A delivery needle is slidably disposed within a needle lumen of each needle housing.

Priority: US201261644134P Applic. Date: 2012-05-08

Inventor: STEIN EMILY A [US]; SWANSON CHRISTINA D [US]; EVANS MICHAEL A [US]; VENKATESWARA-RAO KONDAPAVULUR T [US]


Publication No.: WO2013169886A1  Published: 14/Nov/2013

Title: ANTI-PCSK9 ANTIBODIES AND USE THEREOF

Applicant/Assignee: ALDERBIO HOLDINGS LLC

Application No.: WO2013US40112 (PCT/US2013/40112)   Filing Date: 08/May/2013

Abstract:

The present invention is directed to antibodies and fragments thereof having binding specificity for PCSK9. Another embodiment of this invention relates to the antibodies described herein, and binding fragments thereof, comprising the sequences of the VH, VL and CDR polypeptides described herein, and the polynucleotides encoding them. The invention also contemplates conjugates of anti-PCSK9 antibodies and binding fragments thereof conjugated to one or more functional or detectable moieties. The invention also contemplates methods of making said anti-PCSK9 antibodies and binding fragments thereof. Embodiments of the invention also pertain to the use of anti-PCSK9 antibodies, and binding fragments thereof, for the diagnosis, assessment and treatment of diseases and disorders associated with PCSK9.

Priority: US201261644065P Applic. Date: 2012-05-08; US201261654481P Applic. Date: 2012-06-01; US201313795674 Applic. Date: 2013-03-12

Inventor: FELDHAUS ANDREW LAWRENCE [US]; GARCIA-MARTINEZ LEON F [US]; DUTZAR BENJAMIN H [US]; OJALA ETHAN WAYNE [US]; KOVACEVICH BRIAN ROBERT [US]; OLSON KATIE [US]; FAN PEI [US]; BILLGREN JENS [US]; STEWART ERICA ANN [US]; AKATSUKA CORINNE C [US]; MCNEILL PATRICIA DIANNE [US]; MITCHELL DANIELLE MARIE [US]; ALLISON DAN SCOTT [US]; LATHAM JOHN A [US]


Publication No.: WO2013171167A1  Published: 21/Nov/2013

Title: A XANTHINE DERIVATIVE AS DPP -4 INHIBITOR FOR USE IN THE TREATMENT OF PODOCYTES RELATED DISORDERS AND/OR NEPHROTIC SYNDROME

Applicant/Assignee: BOEHRINGER INGELHEIM INTERNATIONAL GMBH

Application No.: WO2013EP59831 (PCT/EP2013/59831)   Filing Date: 13/May/2013

Abstract:

The present invention relates to methods for treating and/or preventing podocytes related disorders and/or nephrotic syndrome comprising the administration of an effective amount of a certain DPP-4 inhibitor, as well as to the use of a certain DPP-4 inhibitor for treating and/or preventing a metabolic disease in a patient with or at risk of podocytes related disorders and/or nephrotic syndrome.

Priority: EP20120167953 Applic. Date: 2012-05-14; EP20120170888 Applic. Date: 2012-06-05; EP20120006812 Applic. Date: 2012-09-28; EP20120190447 Applic. Date: 2012-10-29

Inventor: KLEIN THOMAS [DE]; VON EYNATTEN MAXIMILIAN [DE]; HOCHER BERTHOLD [DE]; MARK MICHAEL [DE]; SHARKOVSKA YULIYA [DE]


Publication No.: WO2013173076A1  Published: 21/Nov/2013

Title: METHODS AND COMPOSITIONS FOR GENERATING AND USING ALLOGENEIC SUPPRESSOR CELLS

Applicant/Assignee: UNIVERSITY OF SOUTHERN CALIFORNIA

Application No.: WO2013US39287 (PCT/US2013/39287)   Filing Date: 02/May/2013

Abstract:

The present invention is directed to generating suppressor cells by treating naive T cells with a suppressor-inducing composition such as anti-CD3, anti-CD28, IL-2, TGF-beta, or some combination thereof. Such suppressor cells are administered to patients to prevent or treat immune disorders and are allogeneic to the patient.

Priority: US201361798530P Applic. Date: 2013-03-15; US201261642948P Applic. Date: 2012-05-04

Inventor: HORWITZ DAVID A [US]


Publication No.: WO2013173376A1  Published: 21/Nov/2013

Title: hUTC MODULATION OF PRO-INFLAMMATORY MEDIATORS OF LUNG AND PULMONARY DISEASES AND DISORDERS

Applicant/Assignee: DEPUY SYNTHES PRODUCTS, LLC

Application No.: WO2013US41002 (PCT/US2013/41002)   Filing Date: 14/May/2013

Abstract:

This invention encompasses methods, pharmaceutical compositions, and kits, which utilize umbilical cord tissue-derived cells, for modulating (e.g. reducing) the production of pro-inflammatory mediators involved in the pathology of a lung disease, disorder, and/or injury in a patient having the lung disease, disorder, and/or injury. The invention also encompasses methods, pharmaceutical compositions, and kits, which utilize umbilical cord tissue-derived cells, for inhibiting the production of pro-inflammatory mediators involved in the pathology of a lung disease, disorder, and/or injury in a patient having the lung disease, disorder, and/or injury utilizing umbilical cord tissue-derived cells. In one embodiment, the umbilical cord tissue-derived cells are isolated from human umbilical cord tissue substantially free of blood, are capable of self-renewal and expansion in culture, lack the production of CD117 or CD45, and do not express hTERT or telomerase.

Priority: US201213471095 Applic. Date: 2012-05-14

Inventor: KIHM ANTHONY J [US]


Publication No.: WO2013173506A2  Published: 21/Nov/2013

Title: METHOD OF TREATING MUSCULAR DEGRADATION

Applicant/Assignee: RIGEL PHARMACEUTICALS, INC

Application No.: WO2013US41227 (PCT/US2013/41227)   Filing Date: 15/May/2013

Abstract:

A method for treating muscular deterioration is disclosed. Also disclosed are embodiments of a compound, and compositions comprising the compound, for inhibiting muscular deterioriation, including atrophy, dystrophy, and cachexia, such as may result from ventilation.

Priority: US201261647982P Applic. Date: 2012-05-16

Inventor: PAYAN DONALD G [US]; MASUDA ESTEBAN [US]; KINSELLA TODD [US]


Publication No.: WO2013173543A1  Published: 21/Nov/2013

Title: NUCLEOPHILIC CATALYSTS FOR OXIME LINKAGE

Applicant/Assignee: BAXTER INTERNATIONAL INC, BAXTER HEALTHCARE SA

Application No.: WO2013US41280 (PCT/US2013/41280)   Filing Date: 16/May/2013

Abstract:

The invention relates to materials and methods of conjugating a water soluble polymer to an oxidized carbohydrate moiety of a therapeutic protein comprising contacting the oxidized carbohydrate moiety with an activated water soluble polymer under conditions that allow conjugation. More specifically, the present invention relates to the aforementioned materials and methods wherein the water soluble polymer contains an active aminooxy group and wherein an oxime or hydrazone linkage is formed between the oxidized carbohydrate moiety and the active aminooxy group on the water soluble polymer, and wherein the conjugation is carried out in the presence of a nucleophilic catalyst.

Priority: US201261647814P Applic. Date: 2012-05-16; US201213488043 Applic. Date: 2012-06-04

Inventor: SIEKMANN JUERGEN [AT]; HAIDER STEFAN [AT]; ROTTENSTEINER HANSPETER [AT]; TURECEK PETER [AT]


Publication No.: WO2013173676A1  Published: 21/Nov/2013

Title: POLYPEPTIDE AND LIPOPHILIC MOIETY CONJUGATE COMPOSITIONS, FORMULATIONS, AND USES RELATED THERETO

Applicant/Assignee: TUFTS MEDICAL CENTER, INC

Application No.: WO2013US41512 (PCT/US2013/41512)   Filing Date: 17/May/2013

Abstract:

In certain embodiments, this disclosure relates to pharmaceutical formulations for polypeptide and lipophilic moiety conjugates suitable for injection into humans and other animals and methods of preparation. In certain embodiments, the disclosure relates to a method of preparing the formulation comprising lyophilizing, solubilizing in ammonium acetate, filtering to create mono-disperse particles, re-lyophilizing, and solubilizing the micelles in a dextrose solution for injection.

Priority: US201261648789P Applic. Date: 2012-05-18

Inventor: KULIOPULOS ATHAN [US]


Publication No.: WO2013173757A1  Published: 21/Nov/2013

Title: METHOD FOR TREATING NON-SMALL CELL LUNG CANCER

Applicant/Assignee: TEVA PHARMACEUTICAL INDUSTRIES LTD, TEVA PHARMACEUTICALS USA, INC

Application No.: WO2013US41652 (PCT/US2013/41652)   Filing Date: 17/May/2013

Abstract:

The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy' comprising an amount of docetaxel

and 640mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (SEQ ID NO: 1 ), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2'-0-methoxyethyl modifications, has nucleotides 5-17 which are 2'deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.

Priority: US201261649092P Applic. Date: 2012-05-18

Inventor: DUKSIN CHEN [IL]; TESSLER SHOSHI [IL]


Publication No.: WO2013174937A1  Published: 28/Nov/2013

Title: SUBSTITUTED PYRROLIDINES AS FACTOR XIA INHIBITORS FOR THE TREATMENT THROMBOEMBOLIC DISEASES

Applicant/Assignee: ONO PHARMACEUTICAL CO., LTD

Application No.: WO2013EP60650 (PCT/EP2013/60650)   Filing Date: 23/May/2013

Abstract:

The present invention provides compounds of the general formula (I), their salts and N- oxides, and solvates and prodrugs thereof (wherein the substituents are as defined in the description). The compounds of the general formula (I) are inhibitors of factor XIa, and are useful in the prevention of and/or therapy for thromboembolic diseases.

Priority: GB20120009138 Applic. Date: 2012-05-24

Inventor: IMAGAWA AKIRA [JP]; KONDO TAKASHI [JP]; NISHIYAMA TAIHEI [JP]; COURTNEY STEVE [GB]; YARNOLD CHRIS [GB]; ICHIHARA OSAMU [GB]; FLANAGAN STUART [GB]


Publication No.: WO2013175469A1  Published: 28/Nov/2013

Title: COMPOSITIONS AND METHODS FOR THE TREATMENT AND DIAGNOSIS OF NEURODEGENERATIVE DISORDERS

Applicant/Assignee: TECHNION RESEARCH AND DEVELOPMENT FOUNDATION LTD, CARMEL-HAIFA UNIVERSITY ECONOMIC CORPORATION LTD

Application No.: WO2013IL50435 (PCT/IL2013/50435)   Filing Date: 20/May/2013

Abstract:

The invention relates to a method for treating a neurodegenerative disorder and associated pathologies in a subject, specifically, Parkinson disease, using antagonist of ARTS protein. The invention further provides methods for the diagnosis and prognosis of a neurodegenerative disorder as well as methods for determining a treatment regimen for a neurodegenerative disorder. The methods of the invention are based on determining the level of ARTS that is elevated in neurodegenerative disorders.

Priority: US201261649311P Applic. Date: 2012-05-20

Inventor: LARISCH SARIT [IL]; KEMENY STAV [IL]; FINBERG JOHN [IL]


Publication No.: WO2013177194A1  Published: 28/Nov/2013

Title: COMPOSITIONS AND METHODS FOR DECREASING LEUKOCYTE EXTRAVASATION AND VESSEL FLUID LEAKAGE

Applicant/Assignee: UNIVERSITY OF MASSACHUSETTS

Application No.: WO2013US42065 (PCT/US2013/42065)   Filing Date: 21/May/2013

Abstract:

Provided herein are methods of decreasing leukocyte extravasation from a lymph or blood vessel into a tissue in a mammal, methods of decreasing fluid leakage from a lymph or blood vessel in a mammal in need thereof, methods of decreasing formation of atherosclerotic plaques in a mammal in need thereof, and methods of treating atherosclerosis in a mammal that include administering to the mammal an oligonucleotide that decreases Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) mRNA expression in an endothelial cell. Also provided are methods of identifying a candidate agent useful for decreasing leukocyte extravasation or decreasing fluid leakage from a lymph or blood vessel in a mammal, and compositions containing an oligonucleotide that decreases Map4k4 mRNA expression in an endothelial cell and additional therapeutic agents.

Priority: US201261650113P Applic. Date: 2012-05-22

Inventor: CZECH MICHAEL P [US]; FLACH RACHEL ROTH [US]


Publication No.: WO2013178713A1  Published: 05/Dec/2013

Title: STABILIZED GRANULES CONTAINING GLYCERYL TRINITRATE FOR INDUCING ARTERIOGENESIS

Applicant/Assignee: G. POHL-BOSKAMP GMBH & CO. KG

Application No.: WO2013EP61128 (PCT/EP2013/61128)   Filing Date: 29/May/2013

Abstract:

The present invention inter alia relates to a method of treating or preventing an arterial insufficiency, wherein an NO donor is administered in an intermitting manner to a subject in an amount effective for the induction of arteriogenesis, and wherein the NO donor is a solid pharmaceutical preparation with the active substance glyceryl trinitrate for oromucosal or oral administration characterized in that it contains between 0.05 and 2 weight% glyceryl trinitrate (GTN), at least one diluent, one carrier material, and at least one substance that reduces the volatility of GTN, whereby this substance is a non-volatile ester stabilizer whose melting point is not higher than 60 DEG C.

Priority: EP20120004188 Applic. Date: 2012-05-31; US201261653601P Applic. Date: 2012-05-31

Inventor: GORATH MICHAELA [DE]


Publication No.: WO2013178715A1  Published: 05/Dec/2013

Title: INDUCTION OF ARTERIOGENESIS WITH AN NO (NITRIC OXIDE) DONOR

Applicant/Assignee: G. POHL-BOSKAMP GMBH & CO. KG

Application No.: WO2013EP61131 (PCT/EP2013/61131)   Filing Date: 29/May/2013

Abstract:

The present invention inter alia relates to a method of promoting collateral circulation comprising the step of exposing a subject to a therapeutically effective amount of an NO donor wherein the therapeutically effective amount of the NO donor promotes arteriogenesis sufficient to augment collateral circulation in a physiological or pathological condition.

Priority: EP20120004187 Applic. Date: 2012-05-31; US201261653595P Applic. Date: 2012-05-31

Inventor: GORATH MICHAELA [DE]


Publication No.: WO2013179143A2  Published: 05/Dec/2013

Title: SENSITIZATION OF CANCER CELLS BY THE REMOVAL OF SOLUBLE TUMOR NECROSIS FACTOR RECEPTORS

Applicant/Assignee: BIOPHERESIS TECHNOLOGIES, INC

Application No.: WO2013IB01583 (PCT/IB2013/01583)   Filing Date: 31/May/2013

Abstract:

The present invention relates to a molecule binding to soluble tumor necrosis factor receptor (sTNFR) for use in a method for sensitizing a tumor cell in a patient to a treatment with a chemotherapeutic agent, wherein said molecule is immobilized on a solid support that is contacted with a body fluid of said patient. Furthermore, the present invention refers to a method for sensitizing a tumor cell and to a body fluid from which sTNFR has been removed for use in a method for sensitizing a tumor cell in a patient to a treatment with a chemotherapeutic agent. Moreover, the present invention refers to a chemotherapeutic agent for use in a method for treating a tumor in a patient for sensitizing a tumor cell of said tumor in said patient to a treatment with said chemotherapeutic agent.

Priority: WO2012EP02340 Applic. Date: 2012-06-01; EP20120196527 Applic. Date: 2012-12-11

Inventor: BERG SABINE [DE]; WIESNER PETER [DE]


Publication No.: WO2013180834A2  Published: 05/Dec/2013

Title: COMPOSITIONS AND METHODS OF INHIBTING MASP-1 AND/OR MASP-3 FOR THE TREATMENT OF PAROXYSMAL NOCTURNAL HEMOGLOBINURIA

Applicant/Assignee: OMEROS CORPORATION, UNIVERSITY OF LEICESTER

Application No.: WO2013US35488 (PCT/US2013/35488)   Filing Date: 05/Apr/2013

Abstract:

In one aspect, the invention provides methods and compositions for inhibiting MASP-3 -dependent complement activation in a subject suffering from paroxysmal nocturnal hemoglobinuria by administering to the subject a composition comprising an amount of a MASP-3 inhibitory agent in an amount effective to inhibit MASP-3 - dependent complement activation. In another aspect, the invention provides methods and compositions for increasing the survival of red blood cells in a subject suffering from paroxysmal nocturnal hemoglobinuria by administering to the subject a composition comprising an amount of at least one of a MASP-1 inhibitory agent and/or a MASP-3 inhibitory agent effective to increase the survival of red blood cells. In some embodiments, the subject is administered a MASP-2 inhibitory agent and a MASP-1 inhibitory agent, a MASP-2 inhibitory agent and a MASP-3 inhibitory agent administered, a MASP-3 inhibitory agent and a MASP-1 inhibitory agent, or a MASP-1 inhibitory agent, a MASP-2 inhibitory agent and a MASP-3 inhibitory agent.

Priority: US201261621461P Applic. Date: 2012-04-06

Inventor: SCHWAEBLE HANS-WILHELM [GB]; DEMOPULOS GREGORY A [US]


Publication No.: WO2013181691A1  Published: 12/Dec/2013

Title: A METHOD OF TREATMENT AND COMPOSITIONS USEFUL THEREFOR, SCREENING AND PROGNOSTIC AGENTS AND USES THEREFOR

Applicant/Assignee: THE MACFARLANE BURNET INSTITUTE FOR MEDICAL RESEARCH AND PUBLIC HEALTH LTD

Application No.: WO2013AU00582 (PCT/AU2013/00582)   Filing Date: 04/Jun/2013

Abstract:

Disclosed is an assay to stratify a subject as progressing or not-progressing with respect to HIV disease progression, the assay comprising determining the level or activity of CD4+ T cell Glut1 in a biological sample from the HIV infected subject, wherein the level or activity of CD4+ T cell Glut1 in the subject relative to a control identifies the subject as progressing or not progressing also, a method of reducing T cell immune activation and/or inflammation in a subject in need thereof comprising administering to the subject an effective amount of an anti-glycolytic agent or Glut1 antagonist for a time and under conditions sufficient to effectively suppress markers of T cell immune activation or inflammation, or normalise Glut1 levels, glucose uptake or glycolysis in CD4+ T cells in the subject. Methods of reducing HIV infection and reducing HIV associated pathogenesis are also provided. The CD4+ T cell Glut1 antagonist is illustrated using an PI3K-mTOR inhibitor. The PI3K-mTOR inhibitor is a PI3Kgamma inhibitor and/or an mTORC1 inhibitor. Combinations and effective dosages of PI3Kgamma -mTORC1 inhibitors are also provided.

Priority: US201261655432P Applic. Date: 2012-06-04

Inventor: PALMER CLOVIS [AU]; CROWE SUZANNE MARY [AU]


Publication No.: WO2013185024A1  Published: 12/Dec/2013

Title: TREATING BURN AND SCAR INJURY USING TOCOTRIENOL

Applicant/Assignee: THE OHIO STATE UNIVERSITY

Application No.: WO2013US44694 (PCT/US2013/44694)   Filing Date: 07/Jun/2013

Abstract:

The present invention provides methods to improve scar and burn outcome utilizing tocotrienols. In particular, various skin pathologies may be treated using the present methods. The present invention also provides methods to increase skin tissue concentrations of tocotrienols.

Priority: US201261657443P Applic. Date: 2012-06-08

Inventor: SEN CHANDAN [US]; ROY SASHWATI [US]; KHANNA SAVITA [US]; RINK CAMERON [US]


Publication No.: WO2013185032A1  Published: 12/Dec/2013

Title: NANOTHERAPEUTICS FOR DRUG TARGETING

Applicant/Assignee: PRESIDENT AND FELLOWS OF HARVARD COLLEGE

Application No.: WO2013US44709 (PCT/US2013/44709)   Filing Date: 07/Jun/2013

Abstract:

The invention provides compositions and methods for targeted controlled drug release. The compositions and methods can be used for treating or imaging vascular stenosis, stenotic lesions, occluded lumens, embolic phenomena, thrombotic disorders and internal hemorrhage.

Priority: US201261656753P Applic. Date: 2012-06-07

Inventor: INGBER DONALD E [US]; KORIN NETANEL [US]; KANAPATHIPILLAI MATHUMAI [US]; UZUN OKTAY [US]; PAPA ANNE-LAURE [US]


Publication No.: WO2013188073A1  Published: 19/Dec/2013

Title: USE OF HEPARIN AND CARBOHYDRATES TO TREAT CANCER

Applicant/Assignee: EXTHERA MEDICAL, LLC

Application No.: WO2013US42377 (PCT/US2013/42377)   Filing Date: 23/May/2013

Abstract:

The method is described as the removal of mediators that contribute to the pathogenesis of cancer from blood by contacting the blood with a solid, essentially non-micro-porous substrate which has been surface treated with heparin, heparan sulfate and, optionally, other molecules or chemical groups (the adsorbent media or media) having a binding affinity to the mediator, and wherein the size of the interstitial channels within said substrate are balanced with the amount of interstitial substrate surface area such that high flow rates of blood past said substrate creates a flow transport that is characterized by convection transport more than Brownian diffusion transport.

Priority: US201261659337P Applic. Date: 2012-06-13

Inventor: MCCREA KEITH [US]; WARD ROBERT [US]; LARM OLLE [SE]


Publication No.: WO2013188767A1  Published: 19/Dec/2013

Title: METHOD AND SYSTEM FOR MEASURING THE PHARMACOKINETICS OF LIPOSOMAL CURCUMIN AND ITS METABOLITE TETRAHYDROCURCUMIN

Applicant/Assignee: SIGNPATH PARMA, INC

Application No.: WO2013US45898 (PCT/US2013/45898)   Filing Date: 14/Jun/2013

Abstract:

The present invention includes a stabilized curcumin composition. The composition includes a curcumin composition and a phosphate composition, wherein the phosphate composition is non-buffering and is provided in an amount sufficient to stabilize and/or prevent the degradation of curcumin and/or a curcuminoid in a biological sample.

Priority: US201313918112 Applic. Date: 2013-06-14; US201261659660P Applic. Date: 2012-06-14

Inventor: HELSON LAWRENCE [US]


Publication No.: WO2013188787A1  Published: 19/Dec/2013

Title: INHIBITORS OF MICRORNAs THAT REGULATE PRODUCTION OF ATRIAL NATRIURETIC PEPTIDE (ANP) AS THERAPEUTICS AND USES THEREOF

Applicant/Assignee: THE GENERAL HOSPITAL CORPORATION

Application No.: WO2013US45925 (PCT/US2013/45925)   Filing Date: 14/Jun/2013

Abstract:

The present invention relates to methods, kits and compositions to treat hypertension and other cardiovascular diseases in a subject, in particular, a method of treating or preventing a cardiovascular disease in a subject comprising administering to a subject at least one anti-miR agent to miRNA-425. In some embodiments, an anti-miR agent is a small molecule or an oligonucleotide complementary to at least part of the miR-425 of SEQ ID NO: 1, or an anti-miR complementary to at least part of the miRNA seed sequence AUGACA (SEQ ID NO: 2). Another aspect of the present invention relates to methods, kits and compositions to treat low blood pressure in a subject comprising administering a composition comprising a miR-425 agent to decrease ANP levels in the subject. Other aspects of the present invention relates to assays, methods and systems to identify a subject at risk of hypertension, or identifying a subject suitable to administration of an anti-miR-425 agent for treatment of hypertension, the assay comprising assessing if a subject is homozygous or heterozygous for the major (A) allele of rs5068 SNP, and/or assaying for levels of miR-425 and/or assaying for levels of NT-proANP and/or levels of ANP in the plasma of a subject.

Priority: US201261660240P Applic. Date: 2012-06-15

Inventor: BLOCH KENNETH D [US]; ARORA PANKAJ [US]; NEWTON-CHEH CHRISTOPHER [US]; WANG THOMAS J [US]


Publication No.: WO2013190014A1  Published: 27/Dec/2013

Title: IMPROVED CD31 PEPTIDES

Applicant/Assignee: INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM)

Application No.: WO2013EP62806 (PCT/EP2013/62806)   Filing Date: 19/Jun/2013

Abstract:

The present invention provides peptides corresponding to fragments of CD31 that inhibit platelet and leukocyte activation, and to their use in the treatment of thrombotic disease.These peptides find use as therapeutic agents in the treatment of inflammatory diseases and thrombotic diseases such as atherothrombosis, in particular when immobilised onto solid supports.

Priority: EP20120305697 Applic. Date: 2012-06-19

Inventor: CALIGIURI GIUSEPPINA [FR]; NICOLETTI ANTONINO [FR]


Publication No.: WO2013192238A2  Published: 27/Dec/2013

Title: COMPOSITIONS AND METHODS FOR TREATMENT OF DIABETES

Applicant/Assignee: TARIX PHARMACEUTICALS LTD

Application No.: WO2013US46429 (PCT/US2013/46429)   Filing Date: 18/Jun/2013

Abstract:

The present invention relates to compositions and methods for treatment and/or prevention of diabetes or pre-diabetes. In particular, the invention provides compositions and methods for the treatment and/or prevention of diabetes or pre-diabetes, based on the use of angiotensin-(1-7) peptides, functional equivalents thereof, and/or angiotensin (1-7) agonists.

Priority: US201261660888P Applic. Date: 2012-06-18; US201261720296P Applic. Date: 2012-10-30

Inventor: FRANKLIN RICHARD [US]


Publication No.: WO2013192493A1  Published: 27/Dec/2013

Title: NANOPARTICLES OF INDIRUBIN, DERIVATIVES THEREOF AND METHODS OF MAKING AND USING SAME

Applicant/Assignee: PHOSPHOREX, INC

Application No.: WO2013US46981 (PCT/US2013/46981)   Filing Date: 21/Jun/2013

Abstract:

The disclosure provides nanoparticles of indirubin and methods of making and using these particles for the treatment of cancer, neurodegenerative disorders and inflammatory diseases. The effective average particle size of the nanoparticles is less than 2000 nm.

Priority: US201261662469P Applic. Date: 2012-06-21

Inventor: WU BIN [US]

...or search a US patent No (ex:
7666555) or a US patent
application (ex: 2003123456)
or a World (PCT) No (Ex:
2007666555)
Search for anything. Simply
type the words in the box..
 
World Patents Published in 2012
WORLD - PCT PATENT DOCUMENTS IN BLOOD ANTICLOT TECHNOLOGY PUBLISHED FROM IN 2013
This list includes World Patent Documents published by PCT. The list was retrieved by searching the claims section of all patent applications. Salient search terms included drugs,
medications, formulation and devices related to blood anticlotting; blood thinners, anticoagulants, protease enzymes, coumadin and thrombin drugs, thrombin inhibitors, heparin, warfarin
and related technologies. The document search strategy of Formula Scan™ includes proprietary direct and proximity data mining algorithms to retrieve highly relevant documents.