World Patents in Skin Care Actives Published in 2013
WORLD PATENTS IN ACTIVES FOR SKIN CARE GRANTED IN  2013
This list includes patent documents published by the World Intellectual Property Organization (WIPO). The list was retrieved by searching the claims section of all patent applications
published. Salient search terms include skin care active ingredients having properties such as anti-ageing, anti-wrinkle, antioxidant, acne control benefits, skin whitening or lightening,
blemish removal, etc. This category includes technology related to the synthesis and delivery of actives such as peptides, exfoliants, α-hydroxy acids, herbals, free radical scavenger, "green"
derived molecules, etc.

Thank you for visiting FormulaScan . Please click on the WO Patent No to study the full patent document

WIPO - WORLD PATENTS IN SKIN CARE ACTIVES PUBLISHED IN 2013



Publication No.: WO2013007308A1  Published: 17/Jan/2013

Title: PLATELET-RICH PLASMA COMPOSITION FOR TISSUE REPAIR AND REGENERATION

Applicant/Assignee:

Application No.: WO2011EP62045 (PCT/EP2011/62045)   Filing Date: 14/Jul/2011

Abstract:

The present invention relates to platelet-rich plasma (PRP) for epicutaneous use in a wide range of applications in the cosmetic and dermatological fields and to a functional bioactive composition suitable for topical use, which comprises said PRP and allows complete absorption into the skin, hair or scalp, and which has a regenerating action for relaxing expression wrinkles, a lifting effect for sustaining relaxed skin tissues, for scar reduction and wound healing. The present composition performs a regenerating and a repairing action on the skin cell layers, combining the benefits of increasing vitality and longevity of the skin, scalp and hair follicle, without the disadvantages of invasive techniques. The present composition is formulated to allow complete absorption of the PRP and guarantees the vital function of platelet growth factors while combining a gradual, more physiological releasing rate, and stimulating the recruiting of stem cells.

Priority: WO2011EP62045 Applic. Date: 2011-07-14

Inventor: GARBIN STEFANIA [CH]


Publication No.: WO2013007700A1  Published: 17/Jan/2013

Title: PHARMACEUTICAL COMPOSITION COMPRISING OLEIC ACID, PALMITIC ACID, LINOLEIC ACID AND LINOLENIC ACID

Applicant/Assignee:

Application No.: WO2012EP63421 (PCT/EP2012/63421)   Filing Date: 09/Jul/2012

Abstract:

"Pharmaceutical composition". In a first aspect, the present invention relates to a topical cosmetic, dermatological or pharmaceutical composition comprising a mixture of acids consisting of 85-97% by weight of oleic acid, 1.5-6% by weight of palmitic acid, 1.5-6% by weight of linoleic acid, and 0.2-6% by weight of linolenic acid, with respect to the total weight of the acid mixture. In a preferred aspect, the composition of the present invention further comprises hydrogen peroxide. In a second aspect, the present invention relates to a method for preparing such cosmetic composition by mixing such acid mixture with hydrogen peroxide.

Priority: IT2011MI01284 Applic. Date: 2011-07-11

Inventor: NUSCA GIOVANNI [IT]


Publication No.: WO2013007763A1  Published: 17/Jan/2013

Title: MODULATORS OF THE NLRP3 INFLAMMASOME IL-1ss PATHWAY FOR THE PREVENTION AND TREATMENT OF ACNE

Applicant/Assignee: UNIVERSITAET ZUERICH

Application No.: WO2012EP63617 (PCT/EP2012/63617)   Filing Date: 11/Jul/2012

Abstract:

The invention provides inhibitors capable of binding to a member of the inflammasome group comprised of IL-1 ss, IL-1 receptor type 1, NLRP3, ASC, Caspase-1 and cathepsin B with a dissociation constant of 10-8 mol/l or smaller for the prevention and treatment of acne, specifically an antibody, an antibody fragment, an antibody-like molecule, an oligopeptide of 6 to 30 amino acid residues, a nucleic acid aptamer molecule of 10 to 75 nucleotides in length or a soluble polypeptide comprising a contiguous amino acid sequence of at least 30 amino acids comprised within the protein sequence of a member of the group comprised of IL-1 ss, IL-1 receptor type 1, IL-1 receptor type 2, NLRP3, ASC and Caspase-1.

Similarly, an interfering RNA or an antisense modulator of gene expression of IL-1 ss, I L-1 ss receptor type 1, NLRP3, ASC, Caspase-1 and cathepsin B are provided for the prevention or treatment of acne.

Priority: EP20110173700 Applic. Date: 2011-07-12

Inventor: JANKOVIC DRAGANA [CH]; KISTOWSKA MAGDALENA [CH]; CONTASSOT EMMANUEL [FR]; FRENCH LARS E [CH]; GEHRKE SAMUEL [CH]


Publication No.: WO2013007960A1  Published: 17/Jan/2013

Title: USE OF OLIGOSACCHARIDE COMPOUNDS FOR THE PREVENTION AND TREATMENT OF PATHOLOGICAL SCARS

Applicant/Assignee: LABORATOIRES URGO, SOCIETE DE DEVELOPPEMENT ET DE RECHERCHE INDUSTRIELLE

Application No.: WO2012FR51668 (PCT/FR2012/51668)   Filing Date: 12/Jul/2012

Abstract:

The present invention relates to a compound selected among the synthetic polysulphated oligosaccharides having 1 to 4 ose units and the salts and complexes thereof to be used for the treatment of wounds resulting in pathological scars selected among hypertrophic, retractile or atrophic scars. Said use is preferred in particular in patients that have a predisposition to developing hypertrophic, retractile or atrophic scars. According to a second aspect, the invention also relates to said compound for the use thereof in order to inhibit the differentiation of fibroblasts into myofibroblasts during the cicatrisation of wounds resulting in pathological scars selected among hypertrophic, retractile or atrophic scars.

Priority: FR20110056436 Applic. Date: 2011-07-13

Inventor: BOUSCHBACHER MARIELLE [FR]; LAURENSOU CHRISTELLE [FR]


Publication No.: WO2013007961A1  Published: 17/Jan/2013

Title: COSMETIC AND/OR DERMATOLOGICAL USE OF OLIGOSACCHARIDE COMPOUNDS FOR PREVENTING AND TREATING STRETCH MARKS

Applicant/Assignee: LABORATOIRES URGO, SOCIETE DE DEVELOPPEMENT ET DE RECHERCHE INDUSTRIELLE

Application No.: WO2012FR51669 (PCT/FR2012/51669)   Filing Date: 12/Jul/2012

Abstract:

The present invention relates to a topical composition, in particular a cosmetic and/or dermatological composition, to be used for preventing and/or treating stretch marks, including, in a physiologically acceptable medium, an effective amount of at least one synthetic polysulfated oligosaccharide having 1 to 4 glycose units, the salts thereof, and/or the derivatives thereof. The invention also relates to a cosmetic method, in particular for treating stretch marks, including at least one step of applying said composition to the skin.

Priority: FR20110056431 Applic. Date: 2011-07-13

Inventor: APERT LAURENT [FR]; BOUSCHBACHER MARIELLE [FR]


Publication No.: WO2013008249A2  Published: 17/Jan/2013

Title: CELL REGENERATING ANTIOXIDANT

Applicant/Assignee:

Application No.: WO2012IN00449 (PCT/IN2012/00449)   Filing Date: 25/Jun/2012

Abstract:

The present invention relates to cell regenerating antioxidant composition and the process for preparing the same made from commonly available flowers and fruits which includes banana flowers, cucumber fruits and chickpea to regenerate and repair the cells and tissues within the body. The cell regenerating antioxidant composition regenerates and repairs the genetic structure of the cells producing matured adult blood cells by the bone marrow within the body, having right amount of growth factors and blood fuels to be supplied to genetically weak adult cells and tissues thus eliminating major genetic disorders and other cell related disorders through the process of adult cell regeneration.

Priority: IN2011KO00917 Applic. Date: 2011-07-08

Inventor: ARORA ANANT [IN]; AGGARWALA GUNJAN [IN]


Publication No.: WO2013009100A2  Published: 17/Jan/2013

Title: METHOD FOR MANUFACTURING UMBILICAL CORD EXTRACT AND USAGE OF SAME

Applicant/Assignee: CHABIOMED CO., LTD, SUNGKWANG MEDICAL FOUNDATION, CHABIO&DIOSTECH CO., LTD

Application No.: WO2012KR05514 (PCT/KR2012/05514)   Filing Date: 11/Jul/2012

Abstract:

The present invention provides a method for effectively extracting useful ingredients from an umbilical cord. The present invention provides an umbilical cord extract including the useful ingredients. The umbilical cord extract, according to the present invention, can be used as a serum substitute for cultivating ordinary cells and stem cells derived from an animal. Also, the umbilical extract, according to the present invention, can be used for a filler and a dressing for tissue restoration, and for a cosmetic composition for improving the skin. In addition, the present invention relates to a composition for a medium for separating and cultivating stem cells derived from tissue, such as an umbilical cord and fatty tissue, and to a method for separating and cultivating stem cells derived from the tissue using same.

Priority: KR20110068261 Applic. Date: 2011-07-11; KR20110068761 Applic. Date: 2011-07-12

Inventor: CHOI YONG SOO [KR]; KIM SUN MI [KR]; KIM HO JIN [KR]; LEE KWANG HYOUNG [KR]; CHUNG KWANG-HOE [KR]; YOON TAE KI [KR]; LEE YOUNGJUN [KR]; HAN KYUBOEM [KR]; CHUNG HYUNG MIN [KR]


Publication No.: WO2013009543A1  Published: 17/Jan/2013

Title: POLYCYCLIC PYRROLIDINE-2,5-DIONE DERIVATIVES AS -FORMYL PEPTIDE RECEPTOR LIKE-1 (FPRL-1) RECEPTOR MODULATORS

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US45438 (PCT/US2012/45438)   Filing Date: 03/Jul/2012

Abstract:

The present invention relates to novel polycyclic pyrrolidine-2, 5-dione derivatives of formula (I), processes for preparing them, pharmaceutical compositions containing them and their use as pharmaceuticals as modulators the N-formyl peptide receptor like-1 (FPRL-1) receptor.

Priority: US201161506366P Applic. Date: 2011-07-11

Inventor: BEARD RICHARD L [US]; VULIGONDA VIDYASAGAR [US]; VU THONG [US]; DONELLO JOHN E [US]; VISWANATH VEENA [US]; GARST MICHAEL E [US]


Publication No.: WO2013009717A1  Published: 17/Jan/2013

Title: VIRION DERIVED PROTEIN NANOPARTICLES FOR DELIVERING DIAGNOSTIC OR THERAPEUTIC AGENTS FOR THE TREATMENT OF SKIN-RELATED DISEASES

Applicant/Assignee:

Application No.: WO2012US45989 (PCT/US2012/45989)   Filing Date: 09/Jul/2012

Abstract:

This invention relates to a transdermal delivery system for treating skin-related diseases employing papilloma-derived protein nanoparticles to deliver drugs to the keratinocytes and basal membrane cells for the treatment of skin-related diseases. The current invention presents an effective method for delivering small molecule nucleic acids to the epidermal cells.

Priority: US201161506140P Applic. Date: 2011-07-10; US201113221803 Applic. Date: 2011-08-30; US201113253028 Applic. Date: 2011-10-04

Inventor: DE LOS PINOS ELISABET [US]


Publication No.: WO2013009929A2  Published: 17/Jan/2013

Title: LOTIONS DERIVED FROM RENEWABLE RESOURCES AND ABSORBENT ARTICLES COMPRISING SAME

Applicant/Assignee: THE PROCTER & GAMBLE COMPANY

Application No.: WO2012US46338 (PCT/US2012/46338)   Filing Date: 12/Jul/2012

Abstract:

A lotion having an emollient and an immobilizing agent. The emollient is derived from a renewable resource and having a bio-based content of from about 10% to about 100% using ASTM D6866-10, method B and the immobilizing agent selected from the group consisting of C14-C60 fatty alcohols, C14-C60 fatty acids, C14-C60 fatty alcohol ethoxylates having an average degree of ethoxylation ranging from about 2 to about 110, waxes and mixtures thereof. Absorbent articles comprising said lotions are also provided for herein.

Priority: US201113182028 Applic. Date: 2011-07-13

Inventor: WARREN RAPHAEL [US]; WEISMAN PAUL THOMAS [US]


Publication No.: WO2013010032A1  Published: 17/Jan/2013

Title: GEL COMPOSITIONS OF OXYMETAZOLINE AND METHODS OF USE

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US46547 (PCT/US2012/46547)   Filing Date: 12/Jul/2012

Abstract:

Embodiments relating to gels comprising imidazoline alpha agonists, such as, without limitation, oxymetazoline or a pharmaceutically acceptable salt thereof, and methods for treating diseases, such as, without limitation, rosacea, including, for example, erythematotelangiectatic rosacea, papulopustular rosacea, phymatous rosacea, ocular rosacea or combinations thereof

and symptoms associated with rosacea, including, for example, papules, pustules, phymas (skin thickening), telangiectasias or erythema or redness associated with rosacea, other skin erythemas, telangiectasias, purpura or the like, and other manifestations associated therewith or combinations thereof using such gels are described herein.

Priority: US201161507926P Applic. Date: 2011-07-14

Inventor: SHANLER STUART D [US]; POWALA CHRISTOPHER [US]; BROWN MARC BARRY [GB]; LIM SIAN TIONG [GB]; GREENAWAY EVANS CHARLES RODNEY [GB]


Publication No.: WO2013010136A2  Published: 17/Jan/2013

Title: INHIBITORS OF BRUTON'S TYROSINE KINASE

Applicant/Assignee: PHARMACYCLICS, INC, WANG, LONGCHENG

Application No.: WO2012US46779 (PCT/US2012/46779)   Filing Date: 13/Jul/2012

Abstract:

Described herein are kinase inhibitor compounds, methods for synthesizing such inhibitors, and methods for using such inhibitors in the treatment of diseases. Further described herein are methods, assays and systems for determining an appropriate inhibitor of a protein, including a kinase.

Priority: US201161507482P Applic. Date: 2011-07-13

Inventor: CHEN WEI [US]; LOURY DAVID J [US]; MODY TARAK D [US]


Publication No.: WO2013010489A1  Published: 24/Jan/2013

Title: EUCOMMIA EXTRACT, PREPARATION METHOD THEREFOR AND USE THEREOF

Applicant/Assignee: SHANGHAI JAHWA UNITED CO., LTD

Application No.: WO2012CN78865 (PCT/CN2012/78865)   Filing Date: 19/Jul/2012

Abstract:

A preparation method of a eucommia extract comprises: (1) solvent extraction, wherein the solvent is selected from water, methanol, ethanol, isopropanol, 1-butanol, ethylene glycol, 1,2-propanediol, 1,3-propanediol, 1,3-butanediol, acetone, ethyl acetate, or a combination thereof

(2) separation of the extract and residue, to obtain an extract

(3) optional recovery of the solvent

and (4) optional dissolution and dilution. The resulting eucommia extract has antioxidant and is anti-UVA and UVB radiation. The resulting eucommia extract can be used as an active ingredient to prepare anti-skin aging, especially anti-skin photoaging cosmetics or medicines.

Priority: CN20111202162 Applic. Date: 2011-07-19

Inventor: ZHAO YA [CN]; CHEN MO [CN]; ZHU LE [CN]; SUN YI [CN]; YAN SHUXIAN [CN]; REN JIE [CN]; CHENG KANG [CN]; XIONG WEIGUO [CN]; FANG CHENG [CN]; XIANG LEIHONG [CN]


Publication No.: WO2013010963A1  Published: 24/Jan/2013

Title: USE OF COUMARIN DERIVATIVES FOR THE PREPARATION OF DRUGS FOR TREATING SKIN DISEASES

Applicant/Assignee: UNIVERSITE PIERRE ET MARIE CURIE (PARIS 6)

Application No.: WO2012EP63851 (PCT/EP2012/63851)   Filing Date: 13/Jul/2012

Abstract:

The invention relates to a compound of formula (I-1) wherein n equals 0 or 1, Z represents O or S, R1 represents one group chosen among the group consisting ofhydrogen, C1-C7 alkyl, substituted, or not, by a halogen, a hydroxyl or a O-R12 group, wherein R12 is a C1-C7 alkyl, a group CH2OCOR5 wherein R5 is chosen among a hydrogen atom and a C1-C7 alkyl, substituted or not by at least one halogen, a group O-R13, wherein R13 is chosen among hydrogen and a C1-C7 alkyl, an amine or a CH2-amine, R1 represents a group chosen among hydrogen and O-R14, wherein R14 is chosen among hydrogen and a C1-C7 alkyl, and R2 is chosen among the group consisting of a C1-C7 alkyl, a C3-C6 cycloalkyl, an aryl group, and an heteroaryl group for its use for the treatment of pathologies involving an excess of activity of at least one member of the kallikrein family.

Priority: EP20110305931 Applic. Date: 2011-07-15

Inventor: REBOUD RAVAUX MICHELE [FR]; YERROUM EL AMRI CHAHRAZADE [FR]; TAN XIAO [FR]; QIN LIXIAN [FR]; PAGANO MAURICE [FR]; HOVNANIAN ALAIN [FR]; FURIO LAETITIA [FR]; PIROTTE BERNARD [BE]


Publication No.: WO2013011458A1  Published: 24/Jan/2013

Title: A METHOD OF MANAGING CHEMOTHERAPY INDUCED ALOPECIA OR CACHEXIA OR BOTH

Applicant/Assignee: INDUS BIOTECH PRIVATE LIMITED

Application No.: WO2012IB53646 (PCT/IB2012/53646)   Filing Date: 17/Jul/2012

Abstract:

The present disclosure is related to management of chemotherapy induced side effects namely cachexia and alopecia by administering a pharmaceutical composition comprising pentameric type A procyanidin flavonoid, trimeric procyanidin flavonoid and tetrameric procyanidin flavonoid, optionally along with pharmaceutical excipients.

Priority: IN2011MU02058 Applic. Date: 2011-07-19

Inventor: BHASKARAN SUNIL [IN]; VISHWARAMAN MOHAN [IN]


Publication No.: WO2013011679A1  Published: 24/Jan/2013

Title: BACTERICIDAL AGENT AND METHOD FOR PRODUCING SAME

Applicant/Assignee: KABUSHIKI KAISHA OUJU SEIYAKU

Application No.: WO2012JP04547 (PCT/JP2012/04547)   Filing Date: 13/Jul/2012

Abstract:

[Problem] To provide: a bactericidal agent which utilizes a bactericidal activity and a pharmacological activity of a plant belonging to the family Juncaceae, comprises a material produced by seeding a seed mushroom mycelium to a plant belonging to the family Juncaceae, culturing the mycelium while adding a nutrient source to thereby proliferate the mycelium and then drying the proliferated mycelium, can exhibit an excellent bactericidal activity even when used in a small amount, can be added to a food, can be sprayed onto an agricultural crop or soil, and can be used as a therapeutic agent for athlete's foot

and a method for producing the bactericidal agent. [Solution] A plant belonging to the family Juncaceae which is cut into a predetermined length or which is cut into a predetermined length and then milled is mixed with a nutrient source for a seed mushroom mycelium, and the seed mycelium is seeded to the mixture of the plant belonging to the family Juncaceae and the nutrient source and then cultured at a growth temperature for the seed mycelium for a predetermined time period.

Priority: JP20110156607 Applic. Date: 2011-07-15

Inventor: IWAHARA MASAYOSHI [JP]; MORITA HIROSHI [JP]; MIYATA KAZUYUKI [JP]


Publication No.: WO2013011996A1  Published: 24/Jan/2013

Title: POLYPHOSPHORIC ACID COMPOSITION CONTAINING POLYPHOSPHORIC ACID EXTRACTED FROM YEAST CELL, SALT OF POLYPHOSPHORIC ACID OR SOLVATE OF POLYPHOSPHORIC ACID, AND METHOD FOR PRODUCING SAME

Applicant/Assignee: REGENETISS, INC

Application No.: WO2012JP68169 (PCT/JP2012/68169)   Filing Date: 18/Jul/2012

Abstract:

[Problem] The purpose of the present invention is to provide: a polyphosphoric acid composition which has a high cell proliferation enhancing ability, high cell permeability and a high ability of prolonging the lifetime of a cell and can act to enhance the growth of hair and to maintain the growth phase of hair

a polyphosphoric acid composition which is highly safe and contains a naturally synthesized polyphosphoric acid

and a method for producing a polyphosphoric acid composition containing a naturally synthesized polyphosphoric acid. [Solution] According to the present invention, a polyphosphoric acid composition containing a polyphosphoric acid extracted from an yeast cell, a salt of the polyphosphoric acid or a solvate of the polyphosphoric acid can be produced. The polyphosphoric acid composition containing a polyphosphoric acid extracted from an yeast cell, a salt of the polyphosphoric acid or a solvate of the polyphosphoric acid has high cell permeability. When the polyphosphoric acid composition is applied to skin, gum or scalp, the polyphosphoric acid composition can act effectively for the proliferation of a cell, the prolongation of the lifetime of a cell, the growth of hair, and the maintenance of the growth phase of hair.

Priority: JP20110158500 Applic. Date: 2011-07-19

Inventor: SHIBA TOSHIKAZU [JP]; KAWAZOE YUMI [JP]; KATOU SHINICHI [JP]


Publication No.: WO2013012485A2  Published: 24/Jan/2013

Title: NOVEL CRYSTALLINE FORMS OF 3-(4-AMINO-1-OXO-1,3 DIHYDRO-ISOINDOL-2-YL)-PIPERIDINE-2,6-DIONE

Applicant/Assignee: AMPLIO PHARMA, LLC

Application No.: WO2012US41186 (PCT/US2012/41186)   Filing Date: 07/Jun/2012

Abstract:

The invention relates to novel crystalline forms of 3-(4-amino-l-oxo-l,3 dihydro- isoindol-2-yl)-piperidine-2,6-dione, including a novel urea cocrystal of 3-(4-amino-l-oxo-l,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione

a novel gallic acid cocrystal of 3-(4-amino-l-oxo- 1,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione

a novel propyl gallate cocrystal of 3-(4-amino- l-oxo-1,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione

and a novel L- tartaric acid cocrystal of 3- (4- amino- 1-oxo- 1,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione. The preparation and characterization of the novel crystalline forms according to various embodiments of the invention are described. The invention also relates to pharmaceutical compositions containing the novel crystalline forms, and the therapeutic use of the novel crystalline forms.

Priority: US201161509566P Applic. Date: 2011-07-19

Inventor: CHILDS SCOTT L [US]; LINGIREDDY SHREENIVAS R [US]; BARISHANSKY NATHAN [US]


Publication No.: WO2013012644A1  Published: 24/Jan/2013

Title: 2-METHYLENE-20(21)-DEHYDRO-19,24,25,26,27,-PENTANOR-VITAMIN D ANALOGS

Applicant/Assignee: WISCONSIN ALUMNI I RESEARCH FOUNDATION

Application No.: WO2012US46344 (PCT/US2012/46344)   Filing Date: 12/Jul/2012

Abstract:

This invention discloses 2-methylene-20(21)-dehydro-19,24,25,26, 27-pentanor-vitamin D analogs, and specifically 2-methylene-20(21)-dehydro-19,24,25,26,27-pentanor-1a-hydroxyvitamin D3, and pharmaceutical uses therefor. This compound exhibits relatively high transcription activity as well as pronounced activity in arresting the proliferation of undifferentiated cells and inducing their differentiation to the monocyte thus evidencing use as an anti-cancer agent and for the treatment of skin diseases such as psoriasis as well as skin conditions such as wrinkles, slack skin, dry skin and insufficient sebum secretion. This compound also shows lower activity in vivo on bone calcium mobilization and lower in vivo intestinal calcium transport activity as compared to the native hormone 1a,25-dihydroxyvitamin D3, and therefore may be used to treat autoimmune disorders or inflammatory diseases in humans as well as secondary hyperparathyroidism and renal osteodystrophy. This compound may also be used for the treatment or prevention of obesity.

Priority: US201161508882P Applic. Date: 2011-07-18

Inventor: DELUCA HECTOR F [US]; CLAGETT-DAME MARGARET [US]; PLUM LORI A [US]; SICINSKI RAFAL R [PL]; GLEBOCKA AGNIESKA [US]


Publication No.: WO2013013501A1  Published: 31/Jan/2013

Title: TRADITIONAL CHINESE MEDICINE COMPOSITION FOR ENHANCING HUMAN IMMUNE FUNCTION

Applicant/Assignee: JIANGZHONG PHARMACEUTICAL CO., LTD

Application No.: WO2012CN00994 (PCT/CN2012/00994)   Filing Date: 25/Jul/2012

Abstract:

A traditional Chinese medicine composition for enhancing the human immune function. The traditional Chinese medicine composition consists of 5-150 parts of American ginseng by weight, 5-160 parts of Ganoderma lucidum by weight, 1-90 parts of fermented Cordyceps powder by weight and/or 1-120 parts of Cordyceps sinensis by weight, wherein the sources of raw material are Chinese medicinal materials or Chinese herb extracts, the amount of the latter being equivalent to the amount of the crude version of the above-mentioned Chinese medicinal materials

additionally, 5-90 parts of rose flower by weight can also be added. To the above-mentioned composition is added any pharmaceutically acceptable excipient, and any conventional dosage form including but not limited to tablets, granules, capsules, oral liquids, syrups and pills is prepared using conventional methods of traditional Chinese medicine preparation.

Priority: CN20111208868 Applic. Date: 2011-07-25

Inventor: ZHONG HONGGUANG [CN]; LU JIANZHONG [CN]; YI MINZHI [CN]; LI YIGUANG [CN]; MA LI [CN]; GUO YONGJIN [CN]; XU JINZHEN [CN]; YAO MEIXIANG [CN]


Publication No.: WO2013013609A1  Published: 31/Jan/2013

Title: POLYMORPHIC FORMS OF COMPOUNDS AS PROLYL HYDROXYLASE INHIBITOR, AND USES THEREOF

Applicant/Assignee: ZHEJIANG BETA PHARMA INCORPORATION

Application No.: WO2012CN79058 (PCT/CN2012/79058)   Filing Date: 23/Jul/2012

Abstract:

The present invention relates to the polymorphic forms of the compound of Formula (I), preparation thereof including the preparation of intermediates and pharmaceutical compositions, and use of a polymorph above in the treatment of a disease, a disorder or a condition, or in the manufacturing of a medicament for the treatment of a disease, a disorder or a condition.

Priority: CN20111207175 Applic. Date: 2011-07-22; CN20111209657 Applic. Date: 2011-07-25; CN20111211297 Applic. Date: 2011-07-26

Inventor: KANG XINSHAN [CN]; LONG WEI [CN]; ZHANG JIANXI [CN]; HU YUNYAN [CN]; WANG YINXIANG [CN]


Publication No.: WO2013013799A1  Published: 31/Jan/2013

Title: WOUND SPRAY

Applicant/Assignee: SASTOMED GMBH

Application No.: WO2012EP03086 (PCT/EP2012/03086)   Filing Date: 23/Jul/2012

Abstract:

The present invention refers to a composition, comprising hemoglobin or myoglobin, wherein in at least 40% of said hemoglobin or myoglobin the oxygen binding site is charged by a non-02 ligand, and at least one further ingredient, a method for preparing said composition and the use of hemoglobin or myoglobin charged with a non-oxygen ligand for external treatment of wounds.

Priority: EP20110006057 Applic. Date: 2011-07-23

Inventor: SANDER MICHAEL [DE]


Publication No.: WO2013014427A1  Published: 31/Jan/2013

Title: COMPOSITIONS FOR TREATMENT OF SKIN DISORDERS

Applicant/Assignee:

Application No.: WO2012GB51744 (PCT/GB2012/51744)   Filing Date: 20/Jul/2012

Abstract:

Compositions are provided comprising: (i) chlorhexidine or a pharmaceutically acceptable salt thereof

(ii) niacinamide or niacin

and (iii) salicylic acidor a pharmaceutically acceptable salt or derivative thereof. The compositions are suitable for use in treating and preventing disorders of the skin. The compositions are also provided in the form of cosmetic products.

Priority: GB20110012657 Applic. Date: 2011-07-22; GB20120002773 Applic. Date: 2012-02-17

Inventor: LOWE NICHOLAS [GB]; LOWE PHILIPPA [GB]


Publication No.: WO2013014629A1  Published: 31/Jan/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING PYRROLE DIONES AND THEIR USE TO INHIBIT ANGIOGENESIS

Applicant/Assignee: CONGENIA SRL

Application No.: WO2012IB53801 (PCT/IB2012/53801)   Filing Date: 25/Jul/2012

Abstract:

The present invention relates to the use of compounds as angiogenesis inhibitors in the manufacture of a medicament for use in the treatment of disease states associated with angiogenesis, and anti-angiogenic pharmaceutical compositions containing them as active ingredient.

Priority: IT2011TO00667 Applic. Date: 2011-07-25

Inventor: PLYTE SIMON [GB]; FANCELLI DANIELE [IT]; VERASI MARIO [IT]; STORTO MARIANGELA [IT]; NOWAK-SLIWINSKA PATRYCJA [FR]


Publication No.: WO2013014640A1  Published: 31/Jan/2013

Title: PLANT MATERIAL FROM OXYDENDRUM ARBOREUM FOR COSMETIC USE

Applicant/Assignee: SEDERMA

Application No.: WO2012IB53821 (PCT/IB2012/53821)   Filing Date: 26/Jul/2012

Abstract:

The material of plant origin of the invention is obtained from Oxydendrum arboreum, and especially by in vitro plant culture. It can be used as the active ingredient in a topical composition and can be used to improve the appearance and general condition of the skin, mucous membranes or skin appendages, including the fight against aging and/or against the imperfections of the skin, mucous membranes or appendages.

Priority: FR20110056933 Applic. Date: 2011-07-28

Inventor: FOURNIAL ARNAUD [FR]; GRIZAUD CLAIRE-MARIE [FR]; MONDON PHILIPPE [FR]


Publication No.: WO2013014687A1  Published: 31/Jan/2013

Title: PLANTARICINS AND BIOMASS COMPRISING PLANTARICINS FOR USE IN COSMETIC AND MEDICAL FIELDS

Applicant/Assignee: GIULIANI S.P.A

Application No.: WO2012IT00216 (PCT/IT2012/00216)   Filing Date: 12/Jul/2012

Abstract:

The present invention concerns the use of one or more plantaricins chosen between plantaricin A, K or N, preferably plantaricin A, or a biomass comprising one or more plantaricins A, N or K for the stimulation of angiogenesis at follicular level.

Priority: IT2011RM00406 Applic. Date: 2011-07-28

Inventor: GIULIANI GIAMMARIA [IT]; BENEDUSI ANNA [IT]; MARZANI BARBARA [IT]


Publication No.: WO2013015288A1  Published: 31/Jan/2013

Title: LIPASE ACTIVITY INHIBITOR

Applicant/Assignee: NAGASE CHEMTEX CORPORATION

Application No.: WO2012JP68732 (PCT/JP2012/68732)   Filing Date: 24/Jul/2012

Abstract:

Provided are: a lipase activity inhibitor having excellent lipase activity inhibitory action

a cosmetic containing said lipase activity inhibitor

use of a phospholipid for manufacturing said cosmetic

use of a phospholipid for manufacturing a drug, anti-acne agent, anti-obesity agent or anti-inflammatory agent containing said lipase activity inhibitor

a phospholipid for use in inhibiting lipase activity

a phospholipid for use in preventing or treating acne, obesity or inflammation

and a method for preventing or treating acne, obesity or inflammation, including administration of said phospholipids. The present invention pertains to: a lipase activity inhibitor containing a phospholipid as the active ingredient, and a cosmetic, drug, anti-acne agent, anti-obesity agent or anti-inflammatory agent containing said lipase activity inhibitor

use of a phospholipid for manufacturing said cosmetic, drug, anti-acne agent, anti-obesity agent or anti-inflammatory agent

a phospholipid for use in inhibiting lipase activity

a phospholipid for use in preventing or treating acne, obesity or inflammation

and a method for preventing or treating acne, obesity or inflammation, including administration of said phospholipids.

Priority: JP20110162938 Applic. Date: 2011-07-26

Inventor: ATSUMI YUTA [JP]; SHIIHARA MISA [JP]


Publication No.: WO2013015520A1  Published: 31/Jan/2013

Title: NOVEL PEPTIDE FOR INCREASING VEGF EXPRESSION AND PHARMACEUTICAL COMPOSITION INCLUDING SAME

Applicant/Assignee: SNU R&DB FOUNDATION

Application No.: WO2012KR04327 (PCT/KR2012/04327)   Filing Date: 31/May/2012

Abstract:

Provided is a novel peptide for increasing the transcriptional activity of vascular endothelial growth factor (VEGF), which is important for wound treatment by means of activation of the HIF-1a gene, and a pharmaceutical composition including the peptide. The pharmaceutical composition of the present invention has the effects of wound treatment, skin tissue neogenesis, hair growth promotion, and the like.

Priority: KR20110074144 Applic. Date: 2011-07-26

Inventor: LEE MI OCK [KR]; LEE BONG JIN [KR]; KIM EUN JIN [KR]; KIM HYUN HWI [KR]


Publication No.: WO2013015634A2  Published: 31/Jan/2013

Title: PHARMACEUTICAL COMPOSITION FOR TREATING ATOPIC DERMATITIS

Applicant/Assignee: HANALL BIOPHARMA CO., LTD

Application No.: WO2012KR05974 (PCT/KR2012/05974)   Filing Date: 26/Jul/2012

Abstract:

A method of treating mild atopic dermatitis patients by locally administering an external composition containing adenosylcobalamin as an active ingredient is provided. The composition can effectively treat mild atopic dermatitis patients without side effects.

Priority: KR20110074032 Applic. Date: 2011-07-26

Inventor: JUN SUNG SOO [KR]; LEE SOON IM [KR]


Publication No.: WO2013015665A1  Published: 31/Jan/2013

Title: FORMULATION BASED ON AN EXTRACT OF MEDICINAL PLANTS, COAL TAR PITCH AND SALICYLIC ACID FOR THE EFFECTIVE CONTROL OF PSORIASIS, METHOD FOR OBTAINING SAID EXTRACT AND FORMS OF ADMINISTRATION OF THE FORMULATION

Applicant/Assignee:

Application No.: WO2011MX00091 (PCT/MX2011/00091)   Filing Date: 25/Jul/2011

Abstract:

The invention relates to a formulation based on extracts from medicinal plants, coal tar pitch and salicylic acid for the control of psoriasis, to a method for obtaining the extracts and to forms of administration of the formulation. The plant extracts included in the formulation are: walnut (Juglans regia L)., oregano (Origanum vulgare L.), seepwillow (Baccharis salicifolia), thyme (Thymus vulgaris L.), black elderberry (Sambucus nigra), rosemary (Rosmarinus officinalis), nasturtium (Tropaeolum majus L)., soapwort (Saponaria officinalis L.) and Mexican false calico (Loeselia mexicana), in combination with coal tar pitch, salicylic acid and a preservative. The formulation is presented in the form of an ointment, liquid soap and solid soap. The processes of obtaining said three modalities of presentation are described, as are the vehicles and excipients to be added in each case.

Priority: WO2011MX00091 Applic. Date: 2011-07-25

Inventor: AGUILAR SANCHEZ JOSE LUIS [MX]


Publication No.: WO2013016072A1  Published: 31/Jan/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING 4-BROMO-N-(IMIDAZOLIDIN-2-YLIDENE)-1H-BENZIMIDAZOL-5-AMINE FOR TREATING SKIN DISEASES

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US47051 (PCT/US2012/47051)   Filing Date: 17/Jul/2012

Abstract:

The present invention relates to a method for treating skin diseases in a patient in need thereof which comprises of administering a pharmaceutical composition comprising a therapeutically effective amount of 4-bromo-N-(imidazolidin-2-ylidene)-1H-benzimidazol-5-amine or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable excipients.

Priority: US201161510708P Applic. Date: 2011-07-22

Inventor: DIBAS MOHAMMED I [US]; DONELLO JOHN E [US]; GIL DANIEL W [US]


Publication No.: WO2013016086A1  Published: 31/Jan/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING 4-BROMO-N-(IMIDAZOLIDIN-2-YLIDENE)-1H-BENZIMIDAZOL-5-AMINE FOR TREATING SKIN DISEASES

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US47114 (PCT/US2012/47114)   Filing Date: 18/Jul/2012

Abstract:

The present invention relates to a method for treating skin diseases in a patient in need thereof which comprises of administering a pharmaceutical composition comprising a therapeutically effective amount of 4-bromo-N-(imidazolidin-2-ylidene)-1H-benzimidazol-5-amine or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable excipients.

Priority: US201161510708P Applic. Date: 2011-07-22

Inventor: DIBAS MOHAMMED I [US]; DONELLO JOHN E [US]; GIL DANIEL W [US]


Publication No.: WO2013016178A1  Published: 31/Jan/2013

Title: N-(IMIDAZOLIDIN-2-YLIDENE)QUINOLINE DERIVATIVES AS MODULATORS OF ALPHA 2 ADRENERGIC RECEPTORS

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US47570 (PCT/US2012/47570)   Filing Date: 20/Jul/2012

Abstract:

The present invention relates to novel N-(imidazolidin-2-ylidene)quino- line derivatives, processes for preparing them, pharmaceutical compositions containing them and their use as pharmaceuticals. Formula (I).

Priority: US201161511298P Applic. Date: 2011-07-25

Inventor: SINHA SANTOSH C [US]; WANG LIMING [US]; CHOW KEN [US]; DIBAS MOHAMMED I [US]; GARST MICHAEL E [US]


Publication No.: WO2013016220A1  Published: 31/Jan/2013

Title: IL-17 RECEPTOR A IS REQUIRED FOR IL-17C BIOLOGY

Applicant/Assignee: AMGEN INC

Application No.: WO2012US47677 (PCT/US2012/47677)   Filing Date: 20/Jul/2012

Abstract:

The present invention relates to Interleukin-17 ligand and receptor family members and the discovery that IL-17 receptor A and IL-17 receptor E form a heteromeric receptor complex that is biologically active, and that IL-17C activity requires the IL-17RA-IL-17RE heteromeric receptor complex. Antagonists of the IL-17RA-IL-17RE heteromeric receptor complex are disclosed, as well as various methods of use.

Priority: US201161510930P Applic. Date: 2011-07-22; US201261620888P Applic. Date: 2012-04-05

Inventor: BUDELSKY ALISON [US]; TOWNE JENNIFER E [US]; ZHANG YU [US]; SIEGEL LORI [US]; SYMONS ANTONY [US]


Publication No.: WO2013016480A1  Published: 31/Jan/2013

Title: METHODS AND COMPOSITIONS FOR TREATMENT OF EPITHELIAL WOUNDS

Applicant/Assignee:

Application No.: WO2012US48236 (PCT/US2012/48236)   Filing Date: 26/Jul/2012

Abstract:

This invention relates to treatment of epithelial wounds. In particular, the invention relates to methods and formulations for treating epithelial wounds based on application of an opioid antagonist such as naltrexone.

Priority: US201161512577P Applic. Date: 2011-07-28

Inventor: ZAGON IAN S [US]; MCLAUGHLIN PATRICIA J [US]; SASSANI JOSEPH W [US]


Publication No.: WO2013016656A1  Published: 31/Jan/2013

Title: SANDALWOOD OIL AND ITS USES RELATED TO SKIN DISORDERS

Applicant/Assignee: SANTALIS PHARMACEUTICALS INC

Application No.: WO2012US48599 (PCT/US2012/48599)   Filing Date: 27/Jul/2012

Abstract:

Provided herein are compositions of sandalwood heartwood oil and methods of making and using such compositions.

Priority: US201161512647P Applic. Date: 2011-07-28; US201261608279P Applic. Date: 2012-03-08

Inventor: CLEMENTS IAN [US]; CASTELLA PAUL [US]; LEVENSON COREY [US]


Publication No.: WO2013016720A2  Published: 31/Jan/2013

Title: NOVEL SUBSTITUTED BIARYLHETEROCYCLE DERIVATIVES AS PROTEIN KINASE INHIBITORS FOR THE TREATMENT OF CANCER AND OTHER DISEASES

Applicant/Assignee: GERINDA THERAPEUTICS, INC

Application No.: WO2012US48741 (PCT/US2012/48741)   Filing Date: 28/Jul/2012

Abstract:

The present invention provides a new patentable class of substituted benzoxazole derivative compounds that exhibit protein kinase (PK) inhibition activity or modulating ability, as well as compositions and methods of using such compounds, for example, to prevent or treat various diseases and disorders in human and non-human animals.

Priority: US201161512882P Applic. Date: 2011-07-28

Inventor: PFAHL MAGNUS [US]; PIEDRAFITA F JAVIER [US]; VENKAT LAXMAN RAO CILAMKOTI [IN]; VEERAMANENI VENUGOPAL RAO [IN]; VENEPALLI BHASKAR [US]


Publication No.: WO2013017807A1  Published: 07/Feb/2013

Title: ANTISEPTIC COMPOSITION

Applicant/Assignee: PETCARE INNOVATION

Application No.: WO2012FR51838 (PCT/FR2012/51838)   Filing Date: 02/Aug/2012

Abstract:

The invention relates to an antiseptic composition. The composition comprises an association of at least silver metal, preferably in a micronised form, and hyaluronic acid or one of the salts thereof having a molecular weight of between 50 kDa and 2000 kDa. The invention can be especially applied to the field of veterinary medicine, for the treatment of skin wounds and the healing thereof.

Priority: FR20110057144 Applic. Date: 2011-08-04

Inventor: ALLART JEAN-CLAUDE [FR]; LEFEVRE JEAN-MARIE [FR]; PEYROT JACQUES [FR]


Publication No.: WO2013017808A1  Published: 07/Feb/2013

Title: ANTISEPTIC COMPOSITION

Applicant/Assignee: DERMACONCEPT JMC

Application No.: WO2012FR51839 (PCT/FR2012/51839)   Filing Date: 02/Aug/2012

Abstract:

The invention relates to an antiseptic composition. The composition comprises an association of at least silver metal, preferably in a micronised form, and hyaluronic acid or one of the salts thereof having a molecular weight of between 50 kDa and 2000 kDa. The invention can be especially applied to the fields of ophthalmology and dermatology, for the treatment of skin wounds.

Priority: FR20110057144 Applic. Date: 2011-08-04; FR20120054411 Applic. Date: 2012-05-15

Inventor: ALLART JEAN-CLAUDE [FR]; LEFEVRE JEAN-MARIE [FR]; PEYROT JACQUES [FR]


Publication No.: WO2013018371A1  Published: 07/Feb/2013

Title: BIARYL ESTER DERIVATIVE AND DRUG CONTAINING SAME

Applicant/Assignee: KYORIN PHARMACEUTICAL CO., LTD

Application No.: WO2012JP04933 (PCT/JP2012/04933)   Filing Date: 02/Aug/2012

Abstract:

[Problem] To provide a biaryl ester derivative that is more safe and has superior phosphodiesterase 4 inibition. [Solution] The novel biaryl ester derivative, which is represented by general formula (1), and a pharmacologically acceptable salt thereof or a hydrate thereof have superior PDE 4 inhibiting activity and are rapidly metabolized in the body, thus having an activity that attenuates, and so it is possible to suppress systemic adverse effects from arising. From said characteristics, the compound of the present invention is particularly suited to localized administration. In formula (1): A represents a condensed aromatic heterocyclic group represented by formula (a) or formula (b)

and B represents a condensed aromatic heterocyclic group represented by formula (w), formula (x), formula (y), or formula (z).

Priority: JP20110169950 Applic. Date: 2011-08-03

Inventor: KOHNO YASUSHI [JP]; SATO MASANORI [JP]; KOJIMA HIROAKI [JP]; HIGUCHI MORIO [JP]


Publication No.: WO2013018372A1  Published: 07/Feb/2013

Title: AMIDE DERIVATIVE AND DRUG CONTAINING SAME

Applicant/Assignee: KYORIN PHARMACEUTICAL CO., LTD

Application No.: WO2012JP04934 (PCT/JP2012/04934)   Filing Date: 02/Aug/2012

Abstract:

[Problem] To provide a novel amide derivative having greater safety and having superior phosphodiesterase 4 inhibition. [Solution] The novel amide derivative, which is represented by general formula (1), has strong PDE 4 inhibiting activity, and is rapidly metabolized in the body, thus having an activity that attenuates, and so it is possible to suppress systemic adverse effects from arising. From said characteristics, the compound of the present invention is particularly suited to localized administration. In formula (1), A represents a condensed aromatic heterocyclic group represented by formula (a) or formula (b).

Priority: JP20110169948 Applic. Date: 2011-08-03

Inventor: KOHNO YASUSHI [JP]; OCHIAI KOJI [JP]; HIGUCHI MORIO [JP]


Publication No.: WO2013018374A1  Published: 07/Feb/2013

Title: KETONE DERIVATIVE AND DRUG CONTAINING SAME

Applicant/Assignee: KYORIN PHARMACEUTICAL CO., LTD

Application No.: WO2012JP04939 (PCT/JP2012/04939)   Filing Date: 03/Aug/2012

Abstract:

[Problem] To provide a ketone derivative that has greater safety and that has superior phosphodiesterase 4 inhibition. [Solution] The novel ketone derivative, which is represented by general formula (1), has strong PDE 4 inhibitory activity and is rapidly metabolized in the body, thus having an activity that attenuates, and so has increased safety and is particularly suited to localized administration. In formula (1), A represented a condensed aromatic heterocyclic group represented by formula (a) or formula (b).

Priority: JP20110169949 Applic. Date: 2011-08-03

Inventor: KOHNO YASUSHI [JP]; OCHIAI KOJI [JP]; HIGUCHI MORIO [JP]; KITAMURA YOSHIAKI [JP]


Publication No.: WO2013018587A1  Published: 07/Feb/2013

Title: TYROSINASE INHIBITOR PRODUCED USING DRIED EARTHWORM POWDER, AND METHOD FOR PRODUCING SAME

Applicant/Assignee: WELL STONE CO

Application No.: WO2012JP68718 (PCT/JP2012/68718)   Filing Date: 24/Jul/2012

Abstract:

Provided are: a tyrosinase inhibitor having an excellent tyrosinase-inhibiting activity and high safety

and a method for producing a tyrosinase inhibitor. A method for producing a tyrosinase inhibitor, characterized by comprising the steps of: bringing a hydroxycarboxylic acid powder into contact with living earthworm, diluting the resultant mixture with water to adjust the pH value of the resultant solution to 2 to 5 and then holding the pH-adjusted solution for 3 to 180 minutes, or alternatively, bringing an aqueous hydroxycarboxylic acid solution having a pH value of 2 to 5 into contact with living earthworm and then holding the resultant solution for 3 to 180 minutes

washing the living earthworm with water

pulverizing the washed earthworm

and lyophilizing the pulverized product.

Priority: JP20110167720 Applic. Date: 2011-07-29

Inventor: ISHII YOICHI [JP]; ISHII KAZUYUKI [JP]


Publication No.: WO2013018695A1  Published: 07/Feb/2013

Title: HETEROCYCLIC COMPOUND

Applicant/Assignee: TAKEDA PHARMACEUTICAL COMPANY LIMITED

Application No.: WO2012JP69138 (PCT/JP2012/69138)   Filing Date: 27/Jul/2012

Abstract:

To provide a heterocyclic compound which has an ROR?t inhibitory effect. A compound represented by formula (I) or a salt thereof. (In the formula, ring A represents an optionally substituted cyclic group

Q represents a bonding hand or the like

R1 represents a substituent

ring B represents a thiazole ring, an isothiazole ring or a dihydrothiazole ring, each of which can be additionally substituted by a substituent other than R2

and R2 represents an optionally substituted aminocarbonyl-C1-6 alkyl group or the like.)

Priority: JP20110167693 Applic. Date: 2011-07-29

Inventor: YAMAMOTO SATOSHI [JP]; SHIRAI JUNYA [JP]; OCHIDA ATSUKO [JP]; FUKASE YOSHIYUKI [JP]; TOMATA YOSHIHIDE [JP]; SATO AYUMU [JP]; MIURA SHOTARO [JP]; YONEMORI KAZUKO [JP]; KOYAMA RYOKICHI [JP]


Publication No.: WO2013018735A1  Published: 07/Feb/2013

Title: AMIDINE COMPOUND OR SALT THEREOF

Applicant/Assignee: TAISHO PHARMACEUTICAL CO., LTD, TOYAMA CHEMICAL CO., LTD

Application No.: WO2012JP69249 (PCT/JP2012/69249)   Filing Date: 27/Jul/2012

Abstract:

The purpose of the present invention is to provide a novel compound which has an anti-fungal activity on pathogenic fungi including fungi belonging to the genus Candida, the genus Aspergillus and the genus Trichophyton and is useful as a medicinal agent. A compound represented by formula (I) (wherein A1 represents a nitrogen atom or a group represented by formula CR6

A2 and A3 are the same as or different from each other and independently represent a nitrogen atom or a group represented by formula CH

R1 represents an aryl group which may be substituted by 1 to 5 substituents independently selected from a substituent group (2) or the like

R2 and R3 are the same as or different from each other and independently represent a hydrogen atom, a halogen atom, a C1-6 alkyl group, a C1-6 haloalkyl group or a C1-6 alkoxy group

and R4 and R5 are the same as or different from each other and independently represent a hydrogen atom, a C1-6 haloalkyl group, a C1-6 alkyl group or the like) or a salt thereof is useful as an anti-fungal agent.

Priority: JP20110167754 Applic. Date: 2011-07-29

Inventor: TANIKAWA TETSUYA [JP]; USHIKI YASUNOBU [JP]; USHIYAMA FUMIHITO [JP]; YAMAGUCHI TORU [JP]; ONO NAOYA [JP]; YAMAMOTO KEIKO [JP]; TSURUTA RISA [JP]; TSUTSUI YASUHIRO [JP]; FUJINO NORITOMO [JP]; MORI AYUMU [JP]


Publication No.: WO2013018804A1  Published: 07/Feb/2013

Title: URACIL DERIVATIVE AND USE THEREOF FOR MEDICAL PURPOSES

Applicant/Assignee: DAINIPPON SUMITOMO PHARMA CO., LTD

Application No.: WO2012JP69485 (PCT/JP2012/69485)   Filing Date: 31/Jul/2012

Abstract:

The present invention provides: an uracil derivative represented by general formula (I) or a physiologically acceptable salt thereof (in the formula, R1 represents a hydrogen atom, a C1-10 alkyl group, a C2-6 alkene group, or a 3- to 6-membered saturated or 4- to 6-membered unsaturated aliphatic ring group which may contain 1 to 2 hetero atoms independently selected from the group consisting of N, O and S

R2 represents a hydrogen atom, a halogen atom, a cyano group, -NRcRd, -N=CHN(CH3)2, or an C1-3 alkyl group

Ar1 and Ar2 independently represent a 5- to 6-membered aromatic ring group which may contain 1 to 3 hetero atoms independently selected from the group consisting of N, O and S

and L represents a 6-membered aromatic ring group which may contain 1 to 4 nitrogen atoms, a pyrazole group, a triazole group, or an imidazole group)

and a therapeutic or prophylactic agent for various inflammatory diseases associated with elastases, which comprises the compound or the like as an active ingredient.

Priority: JP20110168168 Applic. Date: 2011-08-01

Inventor: SHIRO TOMOYA [JP]; TOBE MASANORI [JP]; KUBOTA KATSUMI [JP]; TAKANASHI YOSUKE [JP]; NAKAMURA TOMOAKI [JP]; SONE TOSHIHIKO [JP]


Publication No.: WO2013018883A1  Published: 07/Feb/2013

Title: CANCER TREATMENT AND/OR PREVENTION DRUG COMPOSITION

Applicant/Assignee: TORAY INDUSTRIES, INC

Application No.: WO2012JP69819 (PCT/JP2012/69819)   Filing Date: 03/Aug/2012

Abstract:

The present invention identifies a cancer antigen protein that is specifically expressed at the surface of cancer cells, and provides an antibody having the protein as a target and an application of the antibody as a cancer treatment and/or prevention agent. The present invention pertains to: an antibody or a fragment thereof that contains a heavy-chain variable region containing sequence numbers 5, 6, and 7 and a light-chain variable region containing sequence numbers 9, 10 and 11, and that has immunological reactivity with the CAPRIN-1 protein

and a drug composition for cancer treatment and/or prevention containing the antibody or fragment as an active ingredient.

Priority: JP20110171303 Applic. Date: 2011-08-04

Inventor: KOBAYASHI SHINICHI [JP]; OKANO FUMIYOSHI [JP]; MINAMIDA YOSHITAKA [JP]; SAITO TAKANORI [JP]


Publication No.: WO2013019163A1  Published: 07/Feb/2013

Title: PARAFFIN IN THERAPY AND AS A COSMETIC PREPARATION

Applicant/Assignee: MEDICOPHARMACIA D.O.O

Application No.: WO2011SI00041 (PCT/SI2011/00041)   Filing Date: 29/Jul/2011

Abstract:

Paraffin containing hopanes and steranes is used is used as an active substance in medicine and/or cosmetics. It is used for the treatment of the following diseases: dermatitis and eczema, papulosquamous disorders,stomatitis and related lesions, preferably psoriasis, atopic dermatitis and aphthous ulcers. These diseases are normally treated with corticosteroid preparations. It is also used for reducing irritation and inflammations resulting from cosmetic treatments or irritations or inflammations treated with cosmetic agents.

Priority: WO2011SI00041 Applic. Date: 2011-07-29

Inventor: DZANIC EMIR [HR]; ALAJBEG IVAN [HR]; ALAJBEG ANDA [HR]


Publication No.: WO2013019974A1  Published: 07/Feb/2013

Title: COMPOSITIONS COMPRISING A RETINOID AND A LINCOSAMIDE ANTIBIOTIC FOR USE IN TREATING ROSACEA

Applicant/Assignee: MEDICIS PHARMACEUTICAL CORPORATION

Application No.: WO2012US49374 (PCT/US2012/49374)   Filing Date: 02/Aug/2012

Abstract:

The invention provides compositions containing a retinoid and a lincosamide antibiotic for the treatment or amelioration of rosacea. The invention also provides methods for treating or ameliorating rosacea using compositions containing a retinoid and a lincosamide antibiotic.

Priority: US201161514364P Applic. Date: 2011-08-02

Inventor: KIMBALL ALEXANDRA B [US]; CHANG ANNE LYNN S [US]


Publication No.: WO2013020182A1  Published: 14/Feb/2013

Title: ANTIOXIDANT TOPICAL COMPOSITIONS

Applicant/Assignee: STIEFEL RESEARCH AUSTRALIA PTY LTD

Application No.: WO2012AU00949 (PCT/AU2012/00949)   Filing Date: 10/Aug/2012

Abstract:

The present invention relates to topical aerosol compositions comprising L-ascorbic acid. The compositions comprise (a) L-ascorbic acid, or a pharmaceutically acceptable salt or ester thereof, (b) water, (c) lower alcohol and (d) an aerosol propellant. In particular embodiments of the invention, the formulations are actuated as an aerosol spray or aerosol foam. The formulations are suitable for minimizing aging of the skin.

Priority: US201161522377P Applic. Date: 2011-08-11

Inventor: FUCHSHUBER LILIAN [AU]; HOULDEN ROBERT JAMES [AU]


Publication No.: WO2013020242A1  Published: 14/Feb/2013

Title: SPRAY FORMULATION OF MESENCHYMAL STEM CELLS FOR THE TREATMENT OF CHRONIC WOUNDS

Applicant/Assignee: PONTIFICIA UNIVERSIDAD CATOLICA DE CHILE

Application No.: WO2012CL00041 (PCT/CL2012/00041)   Filing Date: 07/Aug/2012

Abstract:

The invention relates to therapeutic and medical applications of mesenchymal stem cells by means of a fine mist spray. The mesenchymal stem cells used in the fine mist spray application system are in suspension and can be optionally nanoencapsulated or not.

Priority: CL20110001904 Applic. Date: 2011-08-08

Inventor: EBENSPERGER ROBERTO [CL]


Publication No.: WO2013021021A1  Published: 14/Feb/2013

Title: NOVEL SOFT PDE4 INHIBITORS

Applicant/Assignee: AMAKEM NV

Application No.: WO2012EP65555 (PCT/EP2012/65555)   Filing Date: 09/Aug/2012

Abstract:

The present invention relates to new phosphodiesterase inhibitors, more specifically soft PDE4 inhibitors, compositions, in particular pharmaceuticals, comprising such inhibitors, and to uses of such inhibitors in the treatment and prophylaxis of disease. In particular, the present invention relates to new soft PDE4 inhibitors compositions, in particular pharmaceuticals, comprising such inhibitors, and to uses of such inhibitors in the treatment and prophylaxis of disease. In addition, the invention relates to methods of treatment and use of said compounds in the manufacture of a medicament for the application to a number of therapeutic indications including inflammatory diseases.

Priority: GB20110013689 Applic. Date: 2011-08-09

Inventor: LEYSEN DIRK [BE]; DEFERT OLIVIER [FR]; BOLAND SANDRO [BE]


Publication No.: WO2013021128A2  Published: 14/Feb/2013

Title: USE OF CANNABINOID COMPOUNDS FOR STIMULATING MELANOGENESIS

Applicant/Assignee: L'OREAL

Application No.: WO2012FR51846 (PCT/FR2012/51846)   Filing Date: 03/Aug/2012

Abstract:

The invention relates to the non-therapeutic, cosmetic use, as an agent for coloring keratin materials, of at least one cannabinoid compound selected from among the compounds of general formula (I), as well as the geometric and optical isomers thereof, the cosmetically acceptable acid or base salts thereof, and the hydrates thereof, i.e. the compounds of formula (I) where: R1 is a hydrogen atom or a C1-C30 alkyl group, said alkyl group being optionally substituted with a hydroxyl group (OH)

R2 is a halogen atom, or a group selected from among hydroxyl, thiol (SH), and amino, optionally substituted with one or more C1-C6 alkyl groups

R3 and R4 form an oxo group together with the carbon atom having same, or R3 and R4 are a hydrogen atom

R5 is a hydrogen atom or a C1-C6 alkyl group

X is a heteroatom selected from among the oxygen and sulphur atoms and the divalent group -N(R6)-, where R6 is a hydrogen atom or a C1-C6 alkyl group

is a single or double bond

n is 1, 2 or 3, preferably 1 or 2, it being understood that when R3 and R4 form an oxo group together with the carbon atom having same, and X is an oxygen atom, then R1 cannot be a hydroxymethyl group. The invention also relates to one of said specific cannabinoid compounds, to be used in the treatment of vitiligo or pityriasis versicolor, to non-therapeutic, cosmetic methods for coloring the skin or for treating the whitening of the hair, which includes topically applying, to the skin and/or to the hair, or orally delivering a composition including, in a physiologically acceptable medium, one of said cannabinoid compounds, and to a method for selecting an active agent that promotes the pigmentation of the keratin materials.

Priority: FR20110057213 Applic. Date: 2011-08-05

Inventor: ZUCCOLO MICHELA [FR]; JOURDAIN ROLAND [FR]; BRETON LIONEL [FR]; MACCARRONE MAURO [IT]


Publication No.: WO2013021129A2  Published: 14/Feb/2013

Title: USE OF A CB1 RECEPTOR ANTAGONIST AS A WHITENING AND/OR ANTI-BROWNING AGENT FOR KERATIN MATERIAL

Applicant/Assignee: L'OREAL

Application No.: WO2012FR51847 (PCT/FR2012/51847)   Filing Date: 03/Aug/2012

Abstract:

The invention relates to the non-therapeutic, cosmetic use of at least one CB1 receptor antagonist as a whitening and/or anti-browning agent for keratin materials. The invention also relates to a CB1 receptor antagonist to be used in the treatment of hyperpigmentation disorders. The invention further relates to a non-therapeutic, cosmetic method for whitening the skin and/or the mucous membranes, which includes a step of orally delivering or topically applying, to the skin and/or to the mucous membranes, a CB1 receptor antagonist, and to a method for selecting a whitening and/or anti-browning agent for keratin materials.

Priority: FR20110057214 Applic. Date: 2011-08-05

Inventor: JOURDAIN ROLAND [FR]; ZUCCOLO MICHELA [FR]; BRETON LIONEL [FR]; MACCARRONE MAURO [IT]


Publication No.: WO2013021302A1  Published: 14/Feb/2013

Title: ANTI-OXIDANT HERBAL COMPOSITION

Applicant/Assignee:

Application No.: WO2012IB53809 (PCT/IB2012/53809)   Filing Date: 26/Jul/2012

Abstract:

An anti-oxidant herbal composition comprising Termanalia arjuna extract, Camellia sinensis extract, and Trikatu extract in specific weight percentages and optionally at least one carrier. Use of the composition for treatment and/or prevention of hyperlipidemia and/or ischemic heart disease and a method of preparation of the composition are also provided.

Priority: IN2011MU02240 Applic. Date: 2011-08-09

Inventor: SHUKLA MUKESH HARILAL [IN]; TRIVEDI MITESH PRADIPKUMAR [IN]


Publication No.: WO2013022091A1  Published: 14/Feb/2013

Title: THERAPEUTIC AGENT FOR AUTOIMMUNE DISEASES COMPRISING PD-1 AGONIST

Applicant/Assignee: ONO PHARMACEUTICAL CO., LTD

Application No.: WO2012JP70498 (PCT/JP2012/70498)   Filing Date: 10/Aug/2012

Abstract:

Provided is a prophylactic, symptom-suppressing, and/or therapeutic agent for autoimmune diseases, which presents little risk of infection and mitigates the burden of administering the drugs to the patient. The prophylactic, symptom-suppressing, and/or therapeutic agent having a PD-1 agonist as an active ingredient, is characterized in that: (a) the agent is administered 1 to 10 times within one month of the first administration

(b) the total dose of the PD-1 agonist is 20[mu]g/kg to 1250[mu]g/kg

and (c) no administration is necessary for at least 3 months after the final administration.

Priority: JP20110176022 Applic. Date: 2011-08-11

Inventor: SHIBAYAMA SHIRO [JP]; IMAI MASAMICHI [JP]


Publication No.: WO2013022363A1  Published: 14/Feb/2013

Title: METHOD FOR TREATING INFECTIOUS SKIN DISEASES USING LIVE "PENICILLIUM NOTATUM" FUNGUS

Applicant/Assignee:

Application No.: WO2011RU00592 (PCT/RU2011/00592)   Filing Date: 05/Aug/2011

Abstract:

The invention relates to a method for treating skin diseases using live "Penicillium notatum" fungus. There is still little known about the "Penicillium notatum" fungus. Live "Penicillium notatum" fungus acts in the following ways in the treatment process: 1) as a biological producer of the most effective antibiotic against (particular) pathogenic microorganisms which act as the causative agents of a particular disease

2) as a biological therapeutic vehicle for the efficient delivery of an antibiotic individually to each pathogenic microorganism

3) as a biological vehicle for the removal of dead and infected human body tissue

4) as a biological immunizing agent that protects young, regenerating skin

5) as a biological immunizing agent that protects young skin tissue that has not established immunity against repeated attack from the disease following regeneration. The treatment period for certain infectious skin diseases using live "Penicillium notatum" fungus lasts from three to five days. In the future, it is possible that the live fungus "Penicillium notatum" is used to augment the immunity lost by people under various specific circumstances, such as specific conditions of work and day-to-day activity, a prolonged period in space, loss or reduction in constant gravitational weight, impaired individual immunity caused by space-related factors, and the emergence of new diseases. It can supplement or replace the immunizing microflora of human internal organs. It is likely that the fungus will be domesticated and new species thereof artificially derived specifically for each organ of the human body. It is essential that mankind learns how to use the live fungus "Penicillium notatum" in the field of medicine in view of the fact that its resilience exceeds that of all life forms known to mankind, including the resilience of the microorganisms of the immunizing human microflora.

Priority: WO2011RU00592 Applic. Date: 2011-08-05

Inventor: CHERNOV KONSTANTIN EVSTAFYEVICH [RU]; CHERNOV ALEKSEY KONSTANTINOVICH [RU]


Publication No.: WO2013022369A1  Published: 14/Feb/2013

Title: COMPLEX ZINC AND ALPHA-CHLOROCARBOXYLIC ACID COMPOUNDS FOR TREATING SKIN LESIONS

Applicant/Assignee: OBSCHESTVO S OGRANITCHENNOI OTVETSTVENNOSTJU "OXYGON"

Application No.: WO2011RU00896 (PCT/RU2011/00896)   Filing Date: 14/Nov/2011

Abstract:

The invention relates to the field of medicine, and specifically to preparations for treating skin lesions, in particular viral, benign, precancerous and cancerous, non-metastasizing, dysplastic and inflammatory lesions of the visible mucous membranes, and also viral and fungal skin and nail lesions, and for correcting wrinkles and senile pigment blemishes, said preparations comprising solutions of complex compounds of salts of zinc and alpha-chlorocarboxylic acids of general formula [Zn(RCH2-xClxCOOH)n (?2O)4-n]+2 *2 [RCH2-x Clx???]-, where R = alkyl, ? or Cl, ? = 1-2 and n = 0-4, in a corresponding alpha-chlorocarboxylic acid, wherein the content of zinc in the solution is 0.25-10.0% and the content of acid is 10-90%. The preparation may additionally contain an additive perfume, for example an ethyl ester of the corresponding alpha-chlorocarboxylic acid. The treatment method consists in that 2-5 doses of the preparation, which has been precooled to 10-15 DEG ?, are applied to the affected skin portion with a delay of 1-3 mins between the first and subsequent applications of the preparation. The preparations are stable on storage.

Priority: RU20110132922 Applic. Date: 2011-08-05

Inventor: MARDI SHALVA IOSIFOVITCH [CH]; USTYNYUK LEV ALEXANDROVICH [RU]


Publication No.: WO2013022406A1  Published: 14/Feb/2013

Title: ANGIOPOIETIN-LIKE 4 AND ITS USE IN MODULATING CELL LEAKINESS

Applicant/Assignee: NANYANG TECHNOLOGICAL UNIVERSITY

Application No.: WO2012SG00282 (PCT/SG2012/00282)   Filing Date: 08/Aug/2012

Abstract:

Vascular disruption induced by interactions between tumor-secreted permeability factors and adhesive proteins on endothelial cells facilitates metastasis. The role of tumor secreted angiopoietin-like 4 (cANGPTL4) in vascular leakiness and metastasis is controversial due to the lack of understanding of how cANGPTL4 modulates vascular integrity. Here, we show that cANGPTL4 instigated the disruption of endothelial continuity by directly interacting with three novel binding partners, integrin a5ss1, VEcadherin and claudin-5, in a temporally sequential manner, thus facilitating metastasis. We showed that cANGPTL4 binds and activates integrin a5ss1-mediated Rac1/PAK signaling to weaken cell-cell contacts. cANGPTL4 subsequently associated with and declustered VE-cadherin and claudin-5, leading to endothelial disruption. Interfering with the formation of these cANGPTL4 complexes delayed vascular disruption. In vivo vascular permeability and metastatic assays performed using ANGPTL4-knockout and wild-type mice injected with either control or ANGPTL4-knockdown tumors confirmed that cANGPTL4 induced vascular leakiness and facilitated lung metastasis in mice. Thus, our findings elucidate how cANGPTL4 induces endothelial disruption. Our findings have direct implications for targeting cANGPTL4 to treat cancer and other vascular pathologies.

Priority: US201161521031P Applic. Date: 2011-08-08

Inventor: TAN NGUAN SOON [SG]


Publication No.: WO2013023443A1  Published: 21/Feb/2013

Title: PHARMACEUTICAL APPLICATION OF PEPTIDE OF SOFT-SHELL TURTLE

Applicant/Assignee: JIANGZHONG PHARMACEUTICAL CO., LTD

Application No.: WO2012CN01097 (PCT/CN2012/01097)   Filing Date: 17/Aug/2012

Abstract:

The present invention aims at providing an application of a peptide of a soft-shell turtle in preparing a medicament having a protective feature against radiation hazards. The oligopeptide of the soft-shell turtle of the present invention uses the soft-shell turtle as a main ingredient, with small peptides having a distribution of molecular weights of less than 10,000 daltons, where molecular weights ranging between 140 and 1,000 daltons accounts for over 50%.

Priority: CN20111236297 Applic. Date: 2011-08-18

Inventor: ZHONG HONGGUANG [CN]; LU JIANZHONG [CN]; YI MINZHI [CN]; MA LI [CN]; LIU GENYUN [CN]


Publication No.: WO2013023961A1  Published: 21/Feb/2013

Title: USE OF INTERFERON BETA FOR THE TREATMENT OF ALOPECIA AREATA

Applicant/Assignee: TIGO GMBH

Application No.: WO2012EP65451 (PCT/EP2012/65451)   Filing Date: 07/Aug/2012

Abstract:

The present invention relates to a medicament for the treatment of alopecia areata. Interferon beta of the present invention may be administered to the subject suffering from said disorder topically (e.g. intradermally) or systemically. The present invention further encompasses compositions comprising interferon beta for use as a medicament in the treatment of alopecia areata. Said compositions may comprise other active agents, such as statins. In a preferred embodiment, interferon beta-lb is administered intradermally once a week for 4 to 6 weeks at a dose level of 4.5 to 30 microgram per 10 cm2 treated area.

Priority: DE20111052816 Applic. Date: 2011-08-18

Inventor: GRIGOLEIT HANS-GUENTHER [DE]; IVANOV IVAN G [BG]


Publication No.: WO2013024487A1  Published: 21/Feb/2013

Title: ANTI- VITILIGO COMPOSITION

Applicant/Assignee: SALAFIA ELIZABETH

Application No.: WO2012IN00110 (PCT/IN2012/00110)   Filing Date: 17/Feb/2012

Abstract:

The invention deals with a novel composition for the treatment of vitiligo comprising of: : Benzyl peroxide, Precipitate Sulphur, Clobatesol dipropionate and Trioxaralen.. The ingredients and the concentrations of the ingredients of composition are selected in way to provide superior efficacy and safety even on prolonged use as well as to care of serious adverse effects like atrophy observed with the use of potent steroids.

Priority: IN2011MU02303 Applic. Date: 2011-08-16

Inventor: SALAFIA ANTONIO


Publication No.: WO2013024898A1  Published: 21/Feb/2013

Title: HETEROCYCLIC DERIVATIVE AND PHARMACEUTICAL DRUG

Applicant/Assignee: NIPPON SHINYAKU CO., LTD

Application No.: WO2012JP70902 (PCT/JP2012/70902)   Filing Date: 17/Aug/2012

Abstract:

The primary purpose of the present invention is to provide a novel heterocyclic derivative or a pharmaceutically acceptable salt thereof. Examples of the present invention can include a heterocyclic compound represented by general formula (1), a tautomer thereof, or a pharmaceutically acceptable salt thereof. (In the formula, R1 and R2 are identical or different and represent an aromatic ring or the like, and the ring (A) represents a heterocycle.) This compound or pharmaceutically acceptable salt thereof has high mPGES-1 inhibitory activity and can be used as a prophylactic agent or therapeutic agent for diseases involving mPGES-1, e.g., rheumatoid arthritis, osteoarthritis, temporomandibular joint disease, low back pain, endometriosis, dysmenorrhea, overactive bladder, malignancy, or neurodegenerative disease.

Priority: JP20110179134 Applic. Date: 2011-08-18

Inventor: OTSU HIRONORI [JP]


Publication No.: WO2013025628A1  Published: 21/Feb/2013

Title: JANUS KINASE INHIBITOR COMPOUNDS AND METHODS

Applicant/Assignee: LIGAND PHARMACEUTICALS INCORPORATED

Application No.: WO2012US50622 (PCT/US2012/50622)   Filing Date: 13/Aug/2012

Abstract:

The present invention relates to Janus kinase inhibitor compounds, prodrugs, and compositions thereof. Some embodiments include the use of such compounds and compositions for the treatment or prevention of skin and/or eye disorders. Claimed are prodrug compounds of Formula I, II, III: (Formula I, II, III) wherein: A is selected from the group consisting of phosphono, phosphonomethyl, phosphonooxymethyl, alkylaminocarbonyl, and acetyl

wherein the acetyl is optionally substituted with methyl, ethyl, propyl, isopropyl, amino, methylamino, dimethylamino, benzyl, pyrrolidinyl, hydroxylcarbonylmethyl, and hydroxylated tetrahydropyranyl

The other variables are as defined in the claims.

Priority: US201161523720P Applic. Date: 2011-08-15

Inventor: COLE ANDREW G [US]; JAMES RAY A [US]; SHAO YUEFEI [US]; LETOURNEAU JEFFREY J [US]; QUINTERO JORGE G [US]; RIVIELLO CHRISTOPHER MARK [US]; ZHI LIN [US]


Publication No.: WO2013026453A1  Published: 28/Feb/2013

Title: TREATMENT OF INFLAMMATORY DISORDERS WITH ANTHRACYCLINES

Applicant/Assignee: VALDERM APS

Application No.: WO2012DK50303 (PCT/DK2012/50303)   Filing Date: 22/Aug/2012

Abstract:

The invention relates to pharmaceutical compositions comprising an anthracycline for the treatment of an inflammatory skin disease, wherein both inflammation and infection are factors of the pathogenesis. The inflammatory skin disease may for example be acne. The compositions are in general prepared for direct administration to the skin. The anthracycline is an anthracycline, which does not induce necrosis and/or lasting tissue damage upon application to skin of human beings, for example valrubicin.

Priority: DK20110070462 Applic. Date: 2011-08-22; DK20120070024 Applic. Date: 2012-01-13; DK20120070338 Applic. Date: 2012-06-18

Inventor: DARKO ELISABETH DE [DK]


Publication No.: WO2013026755A1  Published: 28/Feb/2013

Title: METHODS AND COMPOUNDS FOR REDUCING ALLERGIC REACTIONS TO FRAGRANCED PRODUCTS AND PERFUMES

Applicant/Assignee: HDS LIMITED

Application No.: WO2012EP65954 (PCT/EP2012/65954)   Filing Date: 15/Aug/2012

Abstract:

Conventional fragranced products and perfumes often form potent allergens and may also have irritant properties. The invention relates to compounds, compositions, formulations and methods for reducing, avoiding or eliminating allergic contact dermatitis reactions to the oxidation products of odorous chemicals conventionally used in fragranced products and perfumes.

Priority: GB20110014692 Applic. Date: 2011-08-25

Inventor: BASKETTER DAVID [GB]; WHITE IAN [GB]; MCFADDEN JOHN [GB]


Publication No.: WO2013027835A1  Published: 28/Feb/2013

Title: METHOD FOR PRODUCING OPTICALLY ACTIVE NAPHTHALENE COMPOUND

Applicant/Assignee: MITSUBISHI TANABE PHARMA CORPORATION

Application No.: WO2012JP71493 (PCT/JP2012/71493)   Filing Date: 24/Aug/2012

Abstract:

The present invention provides an industrially advantageous method for producing an optically active naphthalene compound which is useful as a therapeutic agent for dermatitis or the like. Specifically, the present invention provides a method for producing an optically active naphthalene compound [I], which comprises: a step of reacting a compound [a-1] and a compound [b-1] with each other in the presence of a base and a catalyst that is composed of a Pd compound and a tertiary phosphine ligand (step a)

a step of asymmetrically hydrogenating a compound [c-1] in the presence of a hydrogen donor and a complex that is prepared from a ruthenium compound and a chiral ligand, or alternatively in the presence of an optically active oxazaborolidine compound (a CBS catalyst) and a boron hydride compound (step b)

and a step of treating a compound [d-1] with a reducing agent (step c). (In the formulae, Ra and Rb represent the same or different lower alkyl groups

and X1 represents a halogen atom.)

Priority: JP20110183867 Applic. Date: 2011-08-25

Inventor: MATSUYAMA KOJI [JP]; HATSUDA MASANORI [JP]; YOSHINAGA MASAHIKO [JP]; YADA MITSUHIRO [JP]; TANIMOTO KOICHI [JP]


Publication No.: WO2013028049A2  Published: 28/Feb/2013

Title: COMPOSITION FOR THE PERCUTANEOUS ADMINISTRATION OF ACTIVE COMPOUNDS PROVIDING A SUITABLE TREATMENT FOR ANDROGENETIC ALOPECIA

Applicant/Assignee: GENOMMA LAB INTERNACIONAL S.A.B DE C.V

Application No.: WO2012MX00078 (PCT/MX2012/00078)   Filing Date: 23/Aug/2012

Abstract:

The invention relates to a composition for percutaneous application in a liquid form, comprising minoxidil, tretinoin, clobetasol proponiate and finasteride as the main active ingredients, in addition to a cosurfactant such as diethylene glycol monoethyl ether (Transcutol P) as a potentiator for the application thereof in the treatment of alopecia. The invention also relates to a transporting vehicle, and coadjuvants for the use thereof in the treatment predominantly of androgenetic alopecia.

Priority: MX20110008984 Applic. Date: 2011-08-25

Inventor: FACI VILLALOBOS PATRICIA [MX]


Publication No.: WO2013029479A1  Published: 07/Mar/2013

Title: MYCOPHENOLIC ACID DERIVATIVE AND PREPARATION METHOD AND USE THEREOF

Applicant/Assignee: SHANGHAI INSTITUTE OF MATERIA MEDICA, CHINESE ACADEMY OF SCIENCES

Application No.: WO2012CN80409 (PCT/CN2012/80409)   Filing Date: 21/Aug/2012

Abstract:

Disclosed in the present invention is a mycophenolic acid derivative shown by the following general formula (V) and the pharmaceutically acceptable salts thereof, wherein L1 is -O-R2, -QCOOR2 or -QCONR2R3, Q is C1 (approx.) C10. Alkylidene or C1 (approx.) C6alkenylene

L2 is -O-R1 or -O-M+. Also provided in the present invention is a pharmaceutical composition containing the mycophenolic acid derivative and pharmaceutically acceptable salts thereof and medicinal adjuvants

the preparation method of the mycophenolic acid derivative and the pharmaceutically acceptable salts thereof

and the application of the mycophenolic acid derivative and the pharmaceutically acceptable salts thereof as immunosuppressive agents.

Priority: CN20111247876 Applic. Date: 2011-08-26

Inventor: DUAN WENHU [CN]; ZUO JIANPING [CN]; LI CHUAN [CN]; CHEN WEI [CN]; TANG WEI [CN]; ZUO LI [CN]; KONG FANGYUAN [CN]; NIU WEI [CN]


Publication No.: WO2013029525A1  Published: 07/Mar/2013

Title: PHARMACEUTICAL COMPOSITION COMPRISING IODINE POLYMER AND GLUCOCORTICOSTEROID FOR TREATING DERMATITIS

Applicant/Assignee: JIANGSU DEDA PHARMACEUTICALS CO. LIMITED

Application No.: WO2012CN80656 (PCT/CN2012/80656)   Filing Date: 28/Aug/2012

Abstract:

A pharmaceutical composition for treating dermatitis consists of 0.01% - 5% of povidone-iodine, 0.01% - 0% of glucocorticosteroid, 0.001% - 0.5% of potassium iodate and the rest of pharmaceutical acceptable carriers, wherein the glucocorticosteroid is propionate or halometasone.

Priority: CN20111251419 Applic. Date: 2011-08-29

Inventor: LIANG BO [CN]; GUO JING [CN]; LU YONG [CN]


Publication No.: WO2013030459A1  Published: 07/Mar/2013

Title: LIPID COMPOSITION FOR THE PREVENTION OR TREATMENT OF SKIN PROBLEMS

Applicant/Assignee: CLANET OY

Application No.: WO2012FI50846 (PCT/FI2012/50846)   Filing Date: 31/Aug/2012

Abstract:

The invention relates to a novel lipid composition. Further, the invention relates to the use of a lipid composition for the treatment, alleviation and prevention of skin problems.

Priority: FI20110005862 Applic. Date: 2011-09-02

Inventor: GRIINARI MIKKO [FI]; BRUHEIM INGE [NO]


Publication No.: WO2013030512A1  Published: 07/Mar/2013

Title: USE OF COMPOSITIONS HAVING A LOW POLYAMINE CONTENT IN THE PREVENTION OR TREATMENT OF ADVERSE EFFECTS LINKED TO CANCER TREATMENT

Applicant/Assignee: NUTRIALYS MEDICAL NUTRITION SA

Application No.: WO2012FR51959 (PCT/FR2012/51959)   Filing Date: 30/Aug/2012

Abstract:

The present invention relates to a composition including less than 600 picomoles, in particular less than 400 picomoles, of biologically-active polyamines per gram of composition, to be used in the prevention or treatment of a patient, in particular a human being or an animal, for skin or mucosa conditions induced by radiotherapy.

Priority: FR20110057646 Applic. Date: 2011-08-30

Inventor: CIPOLLA BERNARD [FR]; ARTIGNAN XAVIER [FR]; MOULINOUX JACQUES-PHILIPPE [FR]


Publication No.: WO2013030669A2  Published: 07/Mar/2013

Title: TREATMENT OF INFLAMMATORY DISEASE OR DISORDER AND COMPOSITIONS THEREFOR

Applicant/Assignee: CREDE OILS (PTY) LTD

Application No.: WO2012IB02058 (PCT/IB2012/02058)   Filing Date: 17/Aug/2012

Abstract:

Embodiments of the invention relate generally to the treatment of inflammatory diseases and disorders and, more particularly, to the treatment of symptoms of inflammatory diseases and disorders using thymoquinone (TQ) alone or in combination with other compounds, including eicosapentaenoic acid (EPA). In one embodiment, the invention provides a pharmaceutical composition suitable for the treatment of at least one symptom of an inflammatory disease or disorder, comprising: an effective amount of thymoquinone

and at least one physiologically-acceptable carrier, wherein an effective amount of thymoquinone is an amount capable of reducing or preventing the at least one symptom of the inflammatory disease or disorder.

Priority: US201161527652P Applic. Date: 2011-08-26

Inventor: CREDE PHILIPP [ZA]


Publication No.: WO2013031003A1  Published: 07/Mar/2013

Title: DNA REPAIR ACCELERATOR AND DNA DAMAGE SUPPRESSANT

Applicant/Assignee: MANDOM CORPORATION

Application No.: WO2011JP69902 (PCT/JP2011/69902)   Filing Date: 01/Sep/2011

Abstract:

A DNA repair accelerator containing a cinchona extract, and a DNA damage suppressant containing at least one from among a cinchona extract, a comfrey extract, an Coffea extract, a Pueraria root extract, a burdock extract, a Coptis extract, a Sophora angustifolia extract, a chlorella extract, a lavender extract, an Oenothera biennis extract, a rose extract, a Gynostemma pentaphyllum extract, a Rabdosia japonica extract, a Lamium album extract, a carrot extract, a Tilia japonica extract, a great burnet extract, a lotus extract, a tea extract and an Abelmoschus esculentus extract.

Priority: WO2011JP69902 Applic. Date: 2011-09-01

Inventor: KURATA RYUICHIRO [JP]; FUJITA FUMITAKA [JP]; OHNISHI KAZUYOSHI [JP]; KURIYAMA KEN-ICHI [JP]


Publication No.: WO2013031403A1  Published: 07/Mar/2013

Title: SKIN-LIGHTENING AGENT

Applicant/Assignee: KAO CORPORATION

Application No.: WO2012JP68193 (PCT/JP2012/68193)   Filing Date: 18/Jul/2012

Abstract:

Provided are a very safe skin-lightening agent, melanin production inhibitor, and dopa-oxidase activity inhibitor. Justicia procumbens or an organic solvent extract thereof is used to inhibit dopa-oxidase activity.

Priority: JP20110190518 Applic. Date: 2011-09-01; JP20120093771 Applic. Date: 2012-04-17

Inventor: KAWASAKI AKIKO [JP]; KIKUCHI MAMIKO [JP]


Publication No.: WO2013031931A1  Published: 07/Mar/2013

Title: CHEMOKINE RECEPTOR ACTIVITY REGULATOR

Applicant/Assignee: KYOWA HAKKO KIRIN CO., LTD

Application No.: WO2012JP72104 (PCT/JP2012/72104)   Filing Date: 31/Aug/2012

Abstract:

Provided is a chemokine receptor activity regulator, etc. containing as the effective component thereof a pyrazolopyrimidine derivative indicated by formula (I) or a pharmaceutically acceptable salt thereof {in the formula, R1 indicates -NR1aR1b (in the formula, R1a and R1b are the same or different, and indicate a hydrogen atom, an aralkyl, etc.), R2 indicates (II) [in the formula, k and m each indicate an integer between 0 and 2, n indicates an integer between 0 and 2, L indicates a single bond, etc., R5 indicates halogen, etc., R6 indicates aryl, etc., x indicates -CR8 (in the formula, R8 indicates a hydrogen atom, etc.), etc., R7 indicates a hydrogen atom, etc.,] etc., R3 indicates -SO2R13 [in the formula, R13 indicates a lower alkoxy, -NR13d(C=0)R13e (in the formula, R13d indicates a hydrogen atom, etc., R13e indicates a lower alkyl, etc.,) etc.,] and R4 indicates a hydrogen atom, etc.}.

Priority: JP20110192130 Applic. Date: 2011-09-02

Inventor: YAMAMOTO KEISUKE [JP]; ARATAKE SEIJI [JP]; HEMMI KAZUKI [JP]; MIZUTANI MIRAI [JP]; SENO YUKO [JP]


Publication No.: WO2013032248A2  Published: 07/Mar/2013

Title: COMPOSITION FOR IMPROVING SKIN CONDITIONS, CONTAINING EXTRACELLULAR DOMAIN OF HUMAN BONE MORPHOGENETIC PROTEIN RECEPTOR 1A AS ACTIVE INGREDIENT

Applicant/Assignee: JOINT CENTER FOR BIOSCIENCES

Application No.: WO2012KR06949 (PCT/KR2012/06949)   Filing Date: 30/Aug/2012

Abstract:

The present invention provides a composition for improving skin conditions, containing the extracellular domain of human bone morphogenetic protein receptor 1a as an active ingredient. The present invention contains the extracellular domain of human bone morphogenetic protein receptor 1a as an active ingredient inside a nanoliposome comprising hydrogenated lecithin as a constituent component, and the particle size is 50-250 nm. The composition of the present invention reduces wrinkles and alleviates atopic dermatitis. In addition, the present invention provides a method for improving skin conditions, comprising the step of administering a composition containing the extracellular domain of human bone morphogenetic protein receptor 1a as an active ingredient to a subject.

Priority: KR20110087615 Applic. Date: 2011-08-31; KR20120092803 Applic. Date: 2012-08-24

Inventor: YANG ZUNG YOON [KR]; YOON BYUNG HAK [KR]; CHOI SEUNG-HYON [KR]


Publication No.: WO2013032846A1  Published: 07/Mar/2013

Title: 2-METHYLENE-19,23,24-TRINOR-1a-HYDROXYVITAMIN D3

Applicant/Assignee: WISCONSIN ALUMNI RESEARCH FOUNDATION

Application No.: WO2012US52029 (PCT/US2012/52029)   Filing Date: 23/Aug/2012

Abstract:

Compounds of Formula (I) are provided where R1 and R2 are independently selected from H or hydroxy protecting groups. Such compounds may be used in preparing pharmaceutical compositions and are useful in treating a variety of biological conditions.

Priority: US201161527795P Applic. Date: 2011-08-26

Inventor: DELUCA HECTOR F [US]; CLAGETT-DAME MARGARET [US]; PLUM LORI A [US]; GLEBOCKA AGNIESZKA [US]; SICINSKI RAFAL [PL]


Publication No.: WO2013033070A1  Published: 07/Mar/2013

Title: COMPOUNDS AND COMPOSITIONS AS c-KIT KINASE INHIBITORS

Applicant/Assignee: IRM LLC

Application No.: WO2012US52621 (PCT/US2012/52621)   Filing Date: 28/Aug/2012

Abstract:

The invention provides compounds of formulae (I) and (II) and pharmaceutical compositions thereof, which are useful as protein kinase inhibitors, as well as methods for using such compounds to treat, ameliorate or prevent a condition associated with abnormal or deregulated kinase activity. In some embodiments, the invention provides methods for using such compounds to treat, ameliorate or prevent diseases or disorders that involve abnormal activation of c-kit or c-kit and PDGFR (PDGFRa, PDGFRss) kinases.

Priority: US201161530028P Applic. Date: 2011-09-01

Inventor: YEH VINCE [US]; LI XIAOLIN [US]; LIU XIAODONG [US]; LOREN JON [US]; MOLTENI VALENTINA [US]; NABAKKA JULIET [US]; NGUYEN BAO [US]; PETRASSI HANK MICHAEL JAMES [US]


Publication No.: WO2013033116A1  Published: 07/Mar/2013

Title: COMPOUNDS AND COMPOSITIONS AS C-KIT KINASE INHIBITORS

Applicant/Assignee: IRM LLC

Application No.: WO2012US52704 (PCT/US2012/52704)   Filing Date: 28/Aug/2012

Abstract:

The invention provides compounds of formulae (I) and (II) and pharmaceutical compositions thereof, which are useful as protein kinase inhibitors, as well as methods for using such compounds to treat, ameliorate or prevent a condition associated with abnormal or deregulated kinase activity. In some embodiments, the invention provides methods for using such compounds to treat, ameliorate or prevent diseases or disorders that involve abnormal activation of c-kit or c-kit and PDGFR (PDGFRa, PDGFRss) kinases.

Priority: US201161530020P Applic. Date: 2011-09-01; US201261675119P Applic. Date: 2012-07-24

Inventor: LIU XIAODONG [US]; LI XIAOLIN [US]; LOREN JON [US]; MOLTENI VALENTINA [US]; NABAKKA JULIET [US]; NGUYEN BAO [US]; PETRASSI HANK MICHAEL JAMES [US]; YEH VINCE [US]


Publication No.: WO2013033167A1  Published: 07/Mar/2013

Title: COMPOUNDS AND COMPOSITIONS AS C-KIT KINASE INHIBITORS

Applicant/Assignee: IRM LLC

Application No.: WO2012US52802 (PCT/US2012/52802)   Filing Date: 29/Aug/2012

Abstract:

The invention provides compounds of formulae (I) and (II) and pharmaceutical compositions thereof, which are useful as protein kinase inhibitors, as well as methods for using such compounds to treat, ameliorate or prevent a condition associated with abnormal or deregulated kinase activity. In some embodiments, the invention provides methods for using such compounds to treat, ameliorate or prevent diseases or disorders that involve abnormal activation of c-kit or c-kit and PDGFR (PDGFRa, PDGFRss) kinases.

Priority: US201161530038P Applic. Date: 2011-09-01

Inventor: MOLTENI VALENTINA [US]; PETRASSI HANK MICHAEL JAMES [US]; LI XIAOLIN [US]; LIU XIAODONG [US]; LOREN JON [US]; NABAKKA JULIET [US]; NGUYEN BAO [US]; YEH VINCE [US]


Publication No.: WO2013033260A1  Published: 07/Mar/2013

Title: USE OF HDL-RELATED MOLECULES TO TREAT AND PREVENT PROINFLAMMATORY CONDITIONS

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2012US52925 (PCT/US2012/52925)   Filing Date: 29/Aug/2012

Abstract:

Molecules and compositions are described for use in the treatment and prevention of pro-inflammatory conditions. HDL-related molecules, including ApoA-I, bovine HDL and HDL mimetics, in particular, are demonstrated to prevent UV-induced cell death and oxidative stress in skin cells and to inhibit tumor growth and development in a variety of cancers. HDL-related molecules can be used as an oral supplement and in other compositions to prevent or treat pro-inflammatory skin conditions and systemic proinflammatory conditions, including Alzheimer's disease and various cancers.

Priority: US201161528447P Applic. Date: 2011-08-29; US201261624333P Applic. Date: 2012-04-15; US201261646772P Applic. Date: 2012-05-14

Inventor: FARIAS-EISNER ROBIN [US]; REDDY SRINIVASA T [US]


Publication No.: WO2013033520A1  Published: 07/Mar/2013

Title: A METHOD FOR REGULATING SKIN PIGMENTATION

Applicant/Assignee: THE GENERAL HOSPITAL CORPORATION

Application No.: WO2012US53317 (PCT/US2012/53317)   Filing Date: 31/Aug/2012

Abstract:

This invention relates to a method for regulating skin pigmentation of a subject, comprising the step of administering the agent for inhibiting the expression or activation of Microphthalmia Transcription Factor (MITF) to the subject who is in need of regulation of skin pigmentation.

Priority: US201161530197P Applic. Date: 2011-09-01

Inventor: FISHER DAVID E [US]; HAQ RIZWAN [US]; WIDLUND HANS RAGNAR VALDEMAR [US]


Publication No.: WO2013033569A1  Published: 07/Mar/2013

Title: HETEROCYCLYLAMINES AS PI3K INHIBITORS

Applicant/Assignee: INCYTE CORPORATION

Application No.: WO2012US53398 (PCT/US2012/53398)   Filing Date: 31/Aug/2012

Abstract:

The present invention provides heterocyclylamine derivatives of Formula (I): wherein the variables are defined herein, that modulate the activity of phosphoinositide 3-kinases (PI3Ks) and are useful in the treatment of diseases related to the activity of PI3Ks including, for example, inflammatory disorders, immune-based disorders, cancer, and other diseases.

Priority: US201161530866P Applic. Date: 2011-09-02; US201261594882P Applic. Date: 2012-02-03; US201261677445P Applic. Date: 2012-07-30

Inventor: LI YUN-LONG [US]; YAO WENQING [US]; COMBS ANDREW P [US]; YUE EDDY W [US]; MEI SONG [US]; ZHU WENYU [US]; GLENN JOSEPH [US]; MADUSKUIE THOMAS P JR [US]; SPARKS RICHARD B [US]; DOUTY BRENT [US]


Publication No.: WO2013033602A2  Published: 07/Mar/2013

Title: FATTY ACID AMIDES, COMPOSITIONS AND METHODS OF USE

Applicant/Assignee:

Application No.: WO2012US53452 (PCT/US2012/53452)   Filing Date: 31/Aug/2012

Abstract:

The invention relates to fatty acid amides

compositions comprising an effective amount of a fatty acid amide

and methods for treating or preventing cancer, a metabolic disease or a neurodegenerative disease comprising the administration of an effective amount of a fatty acid amide.

Priority: US201161529760P Applic. Date: 2011-08-31; US201261596916P Applic. Date: 2012-02-09

Inventor: MILNE JILL C [US]; JIROUSEK MICHAEL R [US]; BEMIS JEAN E [US]; VU CHI B [US]; TING AMAL [US]


Publication No.: WO2013033797A1  Published: 14/Mar/2013

Title: PHARMACEUTICAL COMPOSITION FOR TREATMENT OF BURNS AND INJURIES OF THE SKIN AND ITS PREPARATION PROCESS

Applicant/Assignee:

Application No.: WO2012BR00331 (PCT/BR2012/00331)   Filing Date: 05/Sep/2012

Abstract:

The present invention relates to a pharmaceutical composition for the treatment of burns, bedsores, varicose ulcers and other skin lesions, consisting essentially the novelty of the combination of sodium salicylate and zinc salts, among these, preferably, zinc sulfate, at specific concentrations, and be even associated to silver sulfafdiazine, being the base of the cream constituted by cetostearyl alcohol, cetostearyl ethoxylated alcohol 20 e o

lanoline, propylenoglycol, paraffine, solid vaseline, of mineral oil, methylparaben and propylparaben. The invention also relates to the process for obtaining the composition.

Priority: BR2011PI04620 Applic. Date: 2011-09-09

Inventor: TEIXEIRA DE CARVALHO LUCIA [BR]; SARTO PICCOLO NELSON [BR]; SARTO PICCOLO MONICA [BR]; SARTO PICCOLO MARIA THEREZA [BR]


Publication No.: WO2013034707A1  Published: 14/Mar/2013

Title: USE OF ADAMANTANE DERIVATIVES FOR THE TREATMENT OF ACTINIC KERATOSIS

Applicant/Assignee: MERZ PHARMA GMBH & CO. KGAA

Application No.: WO2012EP67535 (PCT/EP2012/67535)   Filing Date: 07/Sep/2012

Abstract:

Use of an adamantaneamine derivative for the treatment of actinic keratosis.

Priority: EP20110180630 Applic. Date: 2011-09-08; US201161532160P Applic. Date: 2011-09-08

Inventor: KIEHM KEVIN; POOTH RAINER; ABTS HARRY FRANK


Publication No.: WO2013035072A1  Published: 14/Mar/2013

Title: BIOACTIVE NANOFIBRES

Applicant/Assignee:

Application No.: WO2012IB54626 (PCT/IB2012/54626)   Filing Date: 07/Sep/2012

Abstract:

The present invention relates to one or more nanofibres comprising an effective amount of one or more active agents, including one or more active agents being, or obtained, from a plant extract, and methods of using the nanofibres, including in delivery systems suitable for use in therapy or prevention of skin diseases or conditions.

Priority: US201161532437P Applic. Date: 2011-09-08

Inventor: VILE GLENN [NZ]; HOSIE IAIN CAMERON [NZ]; FEASEY SIMON VAUGHAN [NZ]


Publication No.: WO2013035209A1  Published: 14/Mar/2013

Title: METHOD OF APPLYING ETFB TO ABNORMAL PROLIFERATION OF CELL, AND ABNORMAL PROLIFERATION INHIBITOR

Applicant/Assignee: POLA PHARMA INC

Application No.: WO2011JP80247 (PCT/JP2011/80247)   Filing Date: 27/Dec/2011

Abstract:

Provided is a means for distinguishing the abnormal proliferation of a fibroblasts at an early stage and inhibiting the occurrence of the abnormal proliferation. Provided is a method for distinguishing the state of the proliferation of a fibroblast, which employs the degree of expression of an electron transfer flavonoprotein beta subunit (ETFB) as a measure, wherein it is determined that the abnormal proliferation of the fibroblast highly probably occurs when the degree of the expression of the ETFB is high, and it is determined that the proliferation of the fibroblast is highly probably kept in a normal state when the degree of the expression of the ETFB is low. The abnormal proliferation of a fibroblast can be prevented by inhibiting an ETFB.

Priority: JP20110206582 Applic. Date: 2011-09-05

Inventor: HIROKAWA SHIGENARI [JP]; KITAJIMA HIROYUKI [JP]; SHIMANUKI TOMOMASA [JP]


Publication No.: WO2013035997A2  Published: 14/Mar/2013

Title: PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING ALOPECIA COMPRISING TIANEPTINE OR ITS SALT

Applicant/Assignee: KUHNIL PHARM. CO., LTD

Application No.: WO2012KR06698 (PCT/KR2012/06698)   Filing Date: 23/Aug/2012

Abstract:

The present invention provides a pharmaceutical composition for preventing or treating alopecia comprising tianeptine or its pharmaceutically acceptable salt as an active ingredient.

Priority: KR20110089915 Applic. Date: 2011-09-06

Inventor: PARK SO-RA [KR]; SEO SUNG-KI [KR]; LEE MASE [KR]


Publication No.: WO2013036081A2  Published: 14/Mar/2013

Title: COMPOSITION FOR REDUCING SKIN WRINKLES INCLUDING PDE5 INHIBITOR

Applicant/Assignee: SK CHEMICALS CO., LTD

Application No.: WO2012KR07241 (PCT/KR2012/07241)   Filing Date: 07/Sep/2012

Abstract:

Disclosed is a composition effective in reducing skin wrinkles. The composition comprisesa phosphodiesterase 5 (PDE5) inhibitor, preferably the compound of chemical formula 1, more preferably, mirodenafil as an active ingredient. Further disclosed is a method for reducing skin wrinkles using the composition.

Priority: KR20110091940 Applic. Date: 2011-09-09

Inventor: LEE SOO-MIN [KR]; LEE SOOHEUN [KR]; RYU KEUN-HO [KR]; LEE BONG-YONG [KR]; KIM JAE-SUN [KR]; OH JUNG-HOON [KR]; JEON YE-JI [KR]


Publication No.: WO2013036286A2  Published: 14/Mar/2013

Title: RETINAL CYCLODEXTRIN ACETALS AND HEMIACETALS FOR CLARIFYING SKIN COMPLEXION

Applicant/Assignee: ISLAND KINETICS INC

Application No.: WO2012US27826 (PCT/US2012/27826)   Filing Date: 06/Mar/2012

Abstract:

The present invention discloses certain polyene cyclodextrin acetals and hemiacetals that are effective in providing skin clarification, which is useful for the treatment of acne, and skin disfigurements and skin darkening resulting from acne

skin darkening from cancer, diabetes, radiation treatments, chemotherapy, and sun-burn

mitochondrial and DNA dysfunction

age spots

loss of cellular antioxidants

skin changes associated with aging including collagen loss, loss of skin pliability, loss of skin suppleness, skin wrinkles and fine lines, oxidation, damage from radiation, damage from free radicals, and damage from UV

dry skin

xerosis

ichthyosis

dandruff

brownish spots

keratoses

melasma

lentigines

liver spots

skin pigmentation including pigmented spots, dark circles under the eyes, darkened skin, and blemishes

oily skin

warts

eczema

pruritic skin

psoriasis

inflammatory dermatoses

topical inflammation

disturbed keratinization

scalp dryness, and combinations thereof.

Priority: US201113226661 Applic. Date: 2011-09-07

Inventor: PETER DAVID WAYNE [US]; STANEK JOHN DILLON [US]; OROZCO CHERIA L [US]; GUPTA SHYAM K [US]


Publication No.: WO2013037457A1  Published: 21/Mar/2013

Title: TOPICAL PHARMACEUTICAL COMPOSITIONS

Applicant/Assignee: ALMIRALL, S.A

Application No.: WO2012EP03618 (PCT/EP2012/03618)   Filing Date: 29/Aug/2012

Abstract:

Topical pharmaceutical compositions are described comprising, based on the total weight of the composition: (a) 4.0-5.5 wt.% of diclofenac sodium

(b) 1.5-3.0 wt.% of hyaluronic acid, a salt thereof or mixtures thereof

(c) 50-60 wt.% of water

and (d) 30-40 wt.% of a carrier or vehicle other than water. Said compositions are stable and can be safely and easily applied over large surface areas of the skin in an acceptable way by the general patient population for the treatment or prevention of some skin disorders or diseases.

Priority: EP20110382291 Applic. Date: 2011-09-12; US201161534999P Applic. Date: 2011-09-15

Inventor: FIELHAUER SABINE [DE]; MALLWITZ HENNING [DE]; STRAHINJIC IVANA [DE]; TROMMER HAGEN [DE]; WILLERS CHRISTOPH [DE]


Publication No.: WO2013037859A1  Published: 21/Mar/2013

Title: COMPOSITIONS FOR THE TREATMENT OF PERIPHERAL ULCERS OF VARIOUS ORIGINS

Applicant/Assignee: INDENA S.P.A

Application No.: WO2012EP67893 (PCT/EP2012/67893)   Filing Date: 13/Sep/2012

Abstract:

The present invention relates to combinations of an agent that stimulates cell proliferation and an anti-inflammatory/analgesic, which are useful in the treatment of peripheral ulcers of various origins, such as radiation dermatitis, diabetic ulcers, ulcers caused by venous stasis of the limbs, bedsores, and the associated skin infections, proctitis, vulvovaginitis and haemorrhoids with vascular lesions. These combinations can be presented as formulations for topical use.

Priority: IT2011MI01671 Applic. Date: 2011-09-16

Inventor: BOMBARDELLI EZIO [IT]


Publication No.: WO2013039056A1  Published: 21/Mar/2013

Title: COMPOSITION CONTAINING SOY PROTEIN HYDROLYZATE

Applicant/Assignee: ROHTO PHARMACEUTICAL CO., LTD

Application No.: WO2012JP73170 (PCT/JP2012/73170)   Filing Date: 11/Sep/2012

Abstract:

The purpose of the present invention is to provide a novel substance having an activity for promoting adhesion between a cell and collagen. The present invention pertains to the preparing of a composition for promoting adhesion between a cell and collagen by using a soy protein hydrolyzate.

Priority: JP20110198718 Applic. Date: 2011-09-12

Inventor: ABE MASAMICHI [JP]; KUMAZAWA MASUNORI [JP]; MATSUMOTO KOSUKE [JP]


Publication No.: WO2013039350A2  Published: 21/Mar/2013

Title: SKIN COMPOSITION FOR EXTERNAL USE CONTAINING CERAMIDES

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR07378 (PCT/KR2012/07378)   Filing Date: 14/Sep/2012

Abstract:

The present invention provides a ceramide lamella structure comprising a glucoside surfactant, a preparation method thereof, and a skin composition for external use containing the same. According to the skin preparation composition for external use of the present invention, phase stability is very excellent and a greater amount of ceramides can be stably formed according to the stability of ceramides using multilayered lamellar liquid crystals, thereby showing excellent skin moisturizing and skin barrier function repairing effects when applied to the skin.

Priority: KR20110093634 Applic. Date: 2011-09-16

Inventor: PARK SEUNG HAN [KR]; KANG CHAN KOO [KR]; CHAE BYUNG GUEN [KR]; HAN SANG HOON [KR]


Publication No.: WO2013039597A2  Published: 21/Mar/2013

Title: METHOD FOR ENHANCING THE GROWTH AND FULLNESS OF HAIR

Applicant/Assignee: AVON PRODUCTS, INC

Application No.: WO2012US45344 (PCT/US2012/45344)   Filing Date: 03/Jul/2012

Abstract:

New fibroblast growth factor receptor 1 (FGFR1) inhibitors have been identified which are useful for promoting the retention and/or growth of keratin fibers, such as hair of the scalp, hair of the face (moustache, beard, etc.), eyebrows, eyelashes, and the like. The FGFR1 inhibitors may be formulated in effective amounts in a variety of cosmetic and personal care products.

Priority: US201113231329 Applic. Date: 2011-09-13

Inventor: DUGGAN MICHELE C [US]; PARIMOO SATISH [US]; HWANG CHENG S [US]


Publication No.: WO2013040248A1  Published: 21/Mar/2013

Title: HAIR FOLLICLE STEM CELLS AND METHODS OF USE SAME

Applicant/Assignee: UNIVERSITY OF SOUTHERN CALIFORNIA

Application No.: WO2012US55217 (PCT/US2012/55217)   Filing Date: 13/Sep/2012

Abstract:

The disclosure provides isolated hair follicle stem cells (hfSC) having inactivated BMP signaling, which are discovered to express keratin 15. Also provided are hfSC that have constitutively activated BMP signaling and methods of using such hfSC for screening candidate agents suitable for inhibiting BMP signaling in hfSC and promoting hair growth. Further provided are methods of activating hfSC and promoting hair growth from hfSC.

Priority: US201161534828P Applic. Date: 2011-09-14; US201161539936P Applic. Date: 2011-09-27

Inventor: KOBIELAK KRZYSZTOF [US]; KANDYBA EVE [US]


Publication No.: WO2013040269A1  Published: 21/Mar/2013

Title: PRODUCTS FOR HEALING OF TISSUE WOUNDS

Applicant/Assignee: BRIGHAM YOUNG UNIVERSITY

Application No.: WO2012US55248 (PCT/US2012/55248)   Filing Date: 13/Sep/2012

Abstract:

Disclosed are methods for increasing the rate of healing of a tissue wound by administering a composition including a therapeutically effective amount of at least one cationic steroid antimicrobial (CSA). Also disclosed herein are methods of promoting wound healing in a subject in need of such promotion, comprising administering a composition comprising a therapeutically effective amount of at least one CSA. Additionally, disclosed herein are compounds and compositions comprising at least one CSA, or a pharmaceutically acceptable salt thereof, for use in the treatment of a tissue wound. Kits comprising such compositions and instructions on such methods are also contemplated herein.

Priority: US201161534194P Applic. Date: 2011-09-13

Inventor: GENBERG CARL [US]; SAVAGE PAUL B [US]


Publication No.: WO2013040447A2  Published: 21/Mar/2013

Title: COMBINATION THERAPY WITH LOW DOSAGE STRENGTH IMIQUIMOD AND PHOTODYNAMIC THERAPY TO TREAT ACTINIC KERATOSIS

Applicant/Assignee: MEDICIS PHARMACEUTICAL CORPORATION

Application No.: WO2012US55557 (PCT/US2012/55557)   Filing Date: 14/Sep/2012

Abstract:

Priority: US201161534876P Applic. Date: 2011-09-14; US201161535276P Applic. Date: 2011-09-15

Inventor: GOLD MICHAEL [US]; COHEN JOEL [US]; MUNAVALLI GIRISH [US]; MENG TZE-CHIANG [US]


Publication No.: WO2013040649A1  Published: 28/Mar/2013

Title: THERAPEUTICS USING ADIPOSE CELLS AND CELL SECRETIONS

Applicant/Assignee: CELL IDEAS PTY LTD

Application No.: WO2012AU01140 (PCT/AU2012/01140)   Filing Date: 21/Sep/2012

Abstract:

The invention relates to compositions comprising (i) adipose tissue-derived cell secretions or (ii) an adipose tissue-derived cell suspension, optionally comprising adipocytes, or (iii) a combination of adipose tissue-derived cell secretions and an adipose tissue-derived cell suspension, optionally comprising adipocytes, and to their use in pharmaceutical compositions and methods for treatment of various conditions. The invention also relates to improved methods, agents and compositions for cryopreservation of cells.

Priority: AU20110903938 Applic. Date: 2011-09-23; AU20120901350 Applic. Date: 2012-04-04; AU20120903646 Applic. Date: 2012-08-23

Inventor: VESEY GRAHAM [AU]; WEBSTER REBECCA ANNE [AU]; LILISCHKIS RICHARD [AU]


Publication No.: WO2013040801A1  Published: 28/Mar/2013

Title: HYDROXAMIC ACID COMPOUND CONTAINING QUINOLYL AND PREPARATION METHOD THEREOF, AND PHARMACEUTICAL COMPOSITION CONTAINING THIS COMPOUND AND USE THEREOF

Applicant/Assignee: GUANGZHOU ESA BIOTECH CO., LTD

Application No.: WO2011CN80213 (PCT/CN2011/80213)   Filing Date: 27/Sep/2011

Abstract:

Provided in the present invention is a hydroxamic acid compound containing quinolyl as shown in formula (I), at the same time also disclosed is the preparation method of the compound and the use thereof, and a drug containing the hydroxamic acid compound containing quinolyl. Such compounds are inhibitors of protein kinases and/or histone deacetylases, and can be used in the treatment of diseases caused by the abnormal activity of protein kinases and/or histone deacetylases, for example tumours, etc.

Priority: CN20111278403 Applic. Date: 2011-09-19

Inventor: YUN ZIWEI [CN]; WANG HONGTAO [CN]


Publication No.: WO2013041246A1  Published: 28/Mar/2013

Title: YERSINIA OUTER PROTEIN M (YOPM) IN THE TREATMENT OF PSORIASIS

Applicant/Assignee: WESTFAELISCHE WILHELMS-UNIVERSITAET MUENSTER

Application No.: WO2012EP53209 (PCT/EP2012/53209)   Filing Date: 24/Feb/2012

Abstract:

The present invention relates to the use of Yersinia outer protein M (YopM)in the prevention and/or treatment of psoriasis by cutaneous, intradermalor subcutaneous administration. In particular,the present invention relates to the use of YopM in the treatment of plaque psoriasis, guttate psoriasis, inverse psoriasis, pustular psoriasis, erythrodermic psoriasis, arthritis psoriasis.

Priority: EP20110007785 Applic. Date: 2011-09-23; US201161539693P Applic. Date: 2011-09-27

Inventor: RUETER CHRISTIAN [DE]; SCHMIDT ALEXANDER [DE]


Publication No.: WO2013041247A1  Published: 28/Mar/2013

Title: YERSINIA OUTER PROTEIN M (YOPM) IN THE TREATMENT OF PSORIASIS INDUCED BY IMIQUIMOD

Applicant/Assignee: WESTFAELLSCHE WILHELMS-UNIVERSITAET MUENSTER

Application No.: WO2012EP53224 (PCT/EP2012/53224)   Filing Date: 24/Feb/2012

Abstract:

The present invention relates to the use of Yersinia outer protein M (YopM) in the prevention and/or treatment by cutaneous, intradermalor subcutaneous administration,of psoriasis induced by imiquimod or pharmaceutically acceptable saltsthereof or imiquimod derivatives. It further relates to pharmaceutical compositionscomprising YopM and imiquimod and a kit comprising apharmaceutical compositioncontaining YopM and a pharmaceutical composition containing imiquimod.

Priority: EP20110007786 Applic. Date: 2011-09-23; US201161539693P Applic. Date: 2011-09-27

Inventor: RUETER CHRISTIAN [DE]; SCHMIDT ALEXANDER [DE]


Publication No.: WO2013041526A1  Published: 28/Mar/2013

Title: ALKYLAMIDOTHIAZOLES, COSMETIC OR DERMATOLOGICAL PREPARATIONS CONTAINING SAID ALKYLAMIDOTHIAZOLES, AND USE THEREOF TO COMBAT OR PREVENT UNDESIRED PIGMENTATION OF THE SKIN

Applicant/Assignee: BEIERSDORF AG

Application No.: WO2012EP68362 (PCT/EP2012/68362)   Filing Date: 18/Sep/2012

Abstract:

The invention relates to alkylamidothiazoles of general formula (I), wherein R 1 = -Cl-C24 alkyl (linear and branched), -C1-C24 alkenyl (linear and branched), -C1-C8 cycloalkyl, -C1-C8 cycloalkyl-alkylhydroxy, -C1-C24 alkylhydroxy (linear and branched), -C1-C24 alkylamine (linear and branched), -C1-C24 alkylaryl (linear and branched), C1-C24 alkylaryl-alkyl-hydroxy (linear and branched), -C1-C24 alkyl-heteroaryl (linear and branched), -C1-C24-alkyl-O-C1-C24-alkyl (linear and branched), -C1-C24 alkyl morpholino, -C1-C24 alkyl piperidino, -C1-C24 alkyl piperazino, -C1-C24 alkyl-piperazino-N-alkyl. The invention further relates to cosmetic or dermatological preparations having an effective content of one or more alkylamidothiazoles and to the use thereof for the cosmetic or dermatological treatment and/or prophylaxis of undesired skin pigmentation.

Priority: DE20111083259 Applic. Date: 2011-09-23

Inventor: KOLBE LUDGER [DE]; SCHERNER CATHRIN [DE]; AHLHEIT SABRINA [DE]; WOEHRMANN MICHAEL [DE]; MANN TOBIAS [DE]; GERWAT WOLFRAM [DE]; SCHLAEGER TORSTEN [DE]


Publication No.: WO2013041535A1  Published: 28/Mar/2013

Title: AROMATIC AMIDOTHIAZOLES, COSMETIC OR DERMATOLOGICAL PREPARATIONS CONTAINING SAID AROMATIC AMIDOTHIAZOLES, AND USE THEREOF TO COMBAT OR PREVENT UNDESIRED PIGMENTATION OF THE SKIN

Applicant/Assignee: BEIERSDORF AG

Application No.: WO2012EP68373 (PCT/EP2012/68373)   Filing Date: 18/Sep/2012

Abstract:

The invention relates to aromatic amidothiazoles of the general formula, in which R 1 = -C3-C24 aryl (optionally monosubstituted or polysubstituted with -OH, -F, -Cl, -Br, -I, -OMe, -NH2, -CN, acetyl, polysubstituted with hydroxy, wherein said hydroxy functions can be bonded as acetal), -C3-C24 heteroaryl (optionally monosubstituted or polysubstituted with -OH, -F, -Cl, -Br, -I, -OMe, -NH2, -CN, acetyl, polysubstituted with hydroxy, wherein said hydroxy functions can be bonded as acetal), -C3-C24-aryl-C1-C24-alkyl (linear and branched), -C3-C24-heteroaryl-C1-C24-alkyl (linear and branched), -C3-C24-aryl-C1-C24-alkyl-hydroxy (linear and branched), -C3-C24-heteroaryl-C1-C24-alkyl-hydroxy (linear and branched) -2-hydroxyphenyl, -3-hydroxyphenyl, -4-hydroxyphenyl, -pyridin-2-yl, -pyridin-3-yl, -pyridin-4-yl, pyridin-1(2H)-yl, -pyrimidin-2-yl, -pyrazin-2-yl, -pyrimidin-4-yl, -pyridazin-3-yl, - pyridazin-4-yl, -pyrimidin-2-yl, -pyrimidin-5-yl, -1,2,4-triazin-3-yl, -l,3,5-triazin-2-yl, -l,2,3-triazin-4-yl, -l,2,3-triazin-5-yl, -l,2,3,4-tetrazin-5-yl, -l,2,3,5-tetrazin-4-yl, -l,2,4,5-tetrazin-3-yl, -pentazin-6-yl, -thiazole, -imidazole, -oxazole, -isoxazole, -NH-aryl (optionally monosubstituted or polysubstituted with -OH, -F, -Cl, -Br, -I, -OMe, -NH2, -CN, acetyl, polysubstituted with hydroxy, wherein said hydroxy functions can be bonded as acetal), -NH-heteroaryl (optionally monosubstituted or polysubstituted with -OH, -F, -Cl, -Br, -I, -OMe, -NH2, -CN, acetyl, polysubstituted with hydroxy, wherein said hydroxy functions can be bonded as acetal), mono(hydroxyalkyl)-phenyl-, oligo(hydroxyalkyl)-phenyl. The invention further relates to cosmetic or dermatological preparations having an effective content of one or more aromatic amidothiazoles and to the use thereof for the cosmetic or dermatological treatment and/or prophylaxis of undesired skin pigmentation.

Priority: DE20111083271 Applic. Date: 2011-09-23

Inventor: KOLBE LUDGER [DE]; AHLHEIT SABRINA [DE]; WOEHRMANN MICHAEL [DE]; SCHLAEGER TORSTEN [DE]; SCHERNER CATHRIN [DE]; MANN TOBIAS [DE]; GERWAT WOLFRAM [DE]


Publication No.: WO2013041537A1  Published: 28/Mar/2013

Title: HETEROCYCLOCARBONYLAMINOTHIAZOLES, COSMETIC OR DERMATOLOGICAL PREPARATIONS CONTAINING SAID HETEROCYCLOCARBONYLAMINOTHIAZOLES, AND USE THEREOF TO COMBAT OR PREVENT UNDESIRED PIGMENTATION OF THE SKIN

Applicant/Assignee: BEIERSDORF AG

Application No.: WO2012EP68376 (PCT/EP2012/68376)   Filing Date: 18/Sep/2012

Abstract:

The invention relates to heterocyclocarbonylaminothiazoles of general formula (I), wherein R 1 = -morpholino, -piperidin-1-yl, -piperazin-1-yl, -((4-alkyl)-piperazin-1-yl), -pyrrolidinyl, -(1H-pyrrol-1-yl), -azetidin-1-yl, -azepan-1-yl, -2,3,4,5-tetrahydro-1-H-azepin-1-yl, -2,3-dihydro-1H-azepin-1-yl, -1H-azepin-1-yl, -tetrahydro-2H-pyran-4-yl, -4H-pyran-4-yl, -2H-pyran-4-yl, -oxepanyl, -dioxanyl, -tetrahydrofuranyl, -pyrrazolyl. The invention further relates to cosmetic or dermatological preparations having an effective content of one or more heteroalkylamidothiazoles and to the use thereof for the cosmetic or dermatological treatment and/or prophylaxis of undesired skin pigmentation.

Priority: DE20111083283 Applic. Date: 2011-09-23

Inventor: KOLBE LUDGER [DE]; SCHERNER CATHRIN [DE]


Publication No.: WO2013041646A1  Published: 28/Mar/2013

Title: FORMULATION AND TREATMENT FOR ACNE

Applicant/Assignee: ELZBIETA COSMETICS BV

Application No.: WO2012EP68580 (PCT/EP2012/68580)   Filing Date: 20/Sep/2012

Abstract:

The present invention relates to composition comprising Lactobacillus rye ferment, dialkylisosorbide and phospholipid. Preferably, the composition further comprises ethoxylated sorbitan fatty acid ester. The composition has been shown to be effective against infections of closed comedones. The invention further relates to a method of preparing the composition, to a roll-on applicator comprising the composition and to the use of the composition in treatment of closed comedones infections.

Priority: EP20110182258 Applic. Date: 2011-09-21

Inventor: BRAND-GARNYS ELZBIETA EWA [NL]


Publication No.: WO2013041719A1  Published: 28/Mar/2013

Title: TRIPEPTIDE KDPT FOR ANTIAPOPTOTIC TREATMENT

Applicant/Assignee: WESTFAELISCHE WILHELMS-UNIVERSITAET MUENSTER

Application No.: WO2012EP68755 (PCT/EP2012/68755)   Filing Date: 24/Sep/2012

Abstract:

The present invention is related to the tripeptide (l)Lys-(d)Pro-(l)Thr (KdPT) or pharmaceutically acceptable salts thereof for therapeutic, prophylactic therapeutic or cosmetic treatment of a disease with increased apoptosis, wherein the treatment has an anti- apoptotic effect. The present invention is also related to the use of KdPT or pharmaceutically acceptable salts thereof for the manufacture of a pharmaceutical or cosmetic composition for an anti-apoptotic treatment of disorders that are related with increased apoptosis.

Priority: EP20110182561 Applic. Date: 2011-09-23

Inventor: BETTENWORTH DOMINIK [DE]; BOEHM MARKUS [DE]; LUEGERING ANDREAS [DE]


Publication No.: WO2013041859A1  Published: 28/Mar/2013

Title: CANNABINOID-2-RECEPTOR AGONISTS

Applicant/Assignee: ISIS INNOVATION LIMITED

Application No.: WO2012GB52313 (PCT/GB2012/52313)   Filing Date: 19/Sep/2012

Abstract:

The present invention relates to cannabinnoid-2-receptor (CB2R) agonist compounds. The present invention also relates to processes for the preparation of these compounds, to pharmaceutical compositions comprising them and to their use as therapeutic agents for the treatment and/or prevention of diseases or conditions in which CB2R stimulation is beneficial (especially inflammatory conditions).

Priority: GB20110016152 Applic. Date: 2011-09-19

Inventor: CHRISTOU IVY [GB]; CROSS REBECCA LILLIAN [GB]; GIANELLA-BORRADORI MATTEO [GB]; GREAVES DAVID ROBERT [GB]; RUSSELL ANGELA JANE [GB]; WYNNE GRAHAM MICHAEL [GB]


Publication No.: WO2013042782A1  Published: 28/Mar/2013

Title: CONDENSED HETEROCYCLIC COMPOUND

Applicant/Assignee: TAKEDA PHARMACEUTICAL COMPANY LIMITED

Application No.: WO2012JP74282 (PCT/JP2012/74282)   Filing Date: 21/Sep/2012

Abstract:

The purpose of the present invention is to provide a condensed heterocyclic compound having a RORgammat inhibitory activity. A compound represented by formula (I') [wherein each symbol is as defined in the description] (wherein 2-(2-((4-cyanophenyl)amino)-2-oxoethoxy)-N-(9-ethyl-9H-carbazol-3-yl)acetamide and N-(4-cyanophenyl)-N'-(9-ethyl-9H-carbazol-3-yl)-3-methylpentanediamide are excluded) or a salt thereof.

Priority: JP20110207358 Applic. Date: 2011-09-22

Inventor: YAMAMOTO SATOSHI [JP]; SHIRAI JUNYA [JP]; FUKASE YOSHIYUKI [JP]; TOMATA YOSHIHIDE [JP]; SATO AYUMU [JP]; OCHIDA ATSUKO [JP]; YONEMORI KAZUKO [JP]; NAKAGAWA HIDEYUKI [JP]


Publication No.: WO2013042989A1  Published: 28/Mar/2013

Title: PERCUTANEOUSLY ABSORBABLE PREPARATION CONTAINING FENTANYL AND A HOMOLOGUE THEREOF

Applicant/Assignee: TRANSDERM INC, SAMYANG BIOPHARMACEUTICALS CORPORATION

Application No.: WO2012KR07599 (PCT/KR2012/07599)   Filing Date: 21/Sep/2012

Abstract:

The present invention relates to a percutaneously absorbable preparation comprising fentanyl and a homologue thereof or drugs selected from the pharmacologically acceptable salts thereof, a drug adhesive layer which contains skin penetration enhancers and acrylic adhesives, a support layer, a barrier layer and a release layer. The percutaneously absorbable preparation of the present invention may improve skin penetration such that a small amount of drugs may exhibit skin penetration effects similar to those of a large amount of drugs.

Priority: KR20110095787 Applic. Date: 2011-09-22; KR20120105181 Applic. Date: 2012-09-21

Inventor: YU HYUN-SUK [KR]; LEE YOUNG-MOO [KR]; KIM HYUN-WOO [KR]; KIM HEE-SOOK [KR]


Publication No.: WO2013044098A1  Published: 28/Mar/2013

Title: COMPOSITIONS AND METHODS FOR TREATING CONDITIONS OF COMPROMISED SKIN BARRIER FUNCTION

Applicant/Assignee: LIVING PROOF, INC

Application No.: WO2012US56667 (PCT/US2012/56667)   Filing Date: 21/Sep/2012

Abstract:

Compositions and methods of treating conditions of compromised skin barrier function are described.

Priority: US201161537307P Applic. Date: 2011-09-21; US201261607908P Applic. Date: 2012-03-07; US201261607905P Applic. Date: 2012-03-07

Inventor: YU BETTY [US]; LOMAKIN JOSEPH [US]; KANG SOO-YOUNG [US]; ADAMS BENJAMIN W [US]


Publication No.: WO2013044251A1  Published: 28/Mar/2013

Title: ANTI-STRETCH MARK SKIN CREAM AND METHOD FOR MAKING AND USING THEREOF

Applicant/Assignee:

Application No.: WO2012US56951 (PCT/US2012/56951)   Filing Date: 24/Sep/2012

Abstract:

A skin cream and method for making and applying the skin cream having, e.g., a copper component, an ascorbic acid component, a lipid component and a peptide component. The peptide component can include palmitoyl pentapeptide (KTTLS) or hydrolized serecin. The copper component can be a copper solubilizing formulation. The copper solubilizing formulation can include one of (I) copper and a copper-complexing peptide and/or (ii) a copper-complexing protein. The combination of copper and the ascorbic acid component can prevent or reduce a destabilization of the ascorbic acid component.

Priority: US201161538529P Applic. Date: 2011-09-23

Inventor: NEWBURGER AMY [US]; LAHANAS KONSTANTINOS M [US]


Publication No.: WO2013044314A1  Published: 04/Apr/2013

Title: IN VIVO SYNTHESIS OF ELASTIC FIBER

Applicant/Assignee: THE UNIVERSITY OF SYDNEY

Application No.: WO2012AU01179 (PCT/AU2012/01179)   Filing Date: 27/Sep/2012

Abstract:

Disclosed herein are methods of restoring elasticity in tissue using tropoelastin containing compositions.

Priority: AU20110904041 Applic. Date: 2011-09-30

Inventor: MITHIEUX SUZANNE MARIE [AU]; WEISS ANTHONY STEVEN [AU]


Publication No.: WO2013045031A1  Published: 04/Apr/2013

Title: COMPOSITION TO BE APPLIED TO THE SKIN, AND USE THEREOF

Applicant/Assignee: ALNAPHARM GMBH & CO. KG

Application No.: WO2012EP03802 (PCT/EP2012/03802)   Filing Date: 10/Sep/2012

Abstract:

The present invention concerns a composition to be applied to the skin, which comprises a dermatologically compatible vehicle, coconut oil, hazelnut oil and/or avellana oil, and stinging nettle oil, as well as use thereof for the treatment of skin diseases.

Priority: EP20110007992 Applic. Date: 2011-09-30

Inventor: NAHAVANDI ALI [DE]


Publication No.: WO2013045115A1  Published: 04/Apr/2013

Title: CANNABINOID CARBOXYLIC ACIDS, SALTS OF CANNABINOID CARBOXYLIC ACIDS, AND THE PRODUCTION AND USES OF SAME

Applicant/Assignee: THE HEALTH CONCEPT GMBH

Application No.: WO2012EP04107 (PCT/EP2012/04107)   Filing Date: 01/Oct/2012

Abstract:

The invention relates to a compound selected from the group consisting of all stereoisomers and their mixtures of the compounds of general formulas (1)-(4), in which R1 is a straight-chained, branched or cyclic hydrocarbon group with up to 12 C-atoms and X+ is selected from the group consisting of H+, NH4 +, mono, di or trivalent metal cations, NH4 +, primary, secondary, tertiary or quaternary organic ammonium ions with up to 48 C-atoms, which can carry even more functional groups, hydrazinium ion (N2H5 +), hydroxylammonium ion (NH3OH+), guanidinium ion (CN3H6 +), and organic derivatives of (N2H5 +), NH3OH+, and CN3H6 +, which can carry even more functional groups, and similar. A method is also provided for producing these compounds, comprising the following steps: producing synthetic cannabinoid carboxylic acids in a chemical reaction, or extracting natural cannabinoid carboxylic acids from plant material or cell cultures of Cannabis sativa, and adding a suitable inorganic base, a suitable organic base and/or a suitable inorganic or organic salt in a suitable solvent, to the cannabinoid carboxylic acids or cannabinoid carboxylic acid-rich extracts produced in this manner.

Priority: DE201110114528 Applic. Date: 2011-09-29

Inventor: HERKENROTH THOMAS [DE]; STEUP CHRISTIAN [DE]


Publication No.: WO2013045330A2  Published: 04/Apr/2013

Title: DEODORANT

Applicant/Assignee: ERLACOS GMBH

Application No.: WO2012EP68461 (PCT/EP2012/68461)   Filing Date: 19/Sep/2012

Abstract:

The present invention discloses the use of dimethyl isosorbide as an active deodorant agent in skin applications.

Priority: EP20110183097 Applic. Date: 2011-09-28

Inventor: WINDISCH MARTIN [DE]; WIELAND HEINRICH [DE]


Publication No.: WO2013046813A1  Published: 04/Apr/2013

Title: ENHANCER OF EXPRESSION OF BIOLOGICAL DEFENSE FUNCTION FACTOR

Applicant/Assignee: NISHIHARA CO., LTD

Application No.: WO2012JP65011 (PCT/JP2012/65011)   Filing Date: 12/Jun/2012

Abstract:

Provided is an enhancer of the expression of a biological defense function factor, which can be achieved as a novel use application of a licorice extract. The enhancer of the expression of a biological defense function factor comprises, as an active ingredient, a licorice extract that is soluble in water and ethanol and does not contain glycyrrhizin or glabridin, has an activity of enhancing the expression of BCL-XL, survivin, P53, SOD and HO-1 that are biological defense function factors, and also has an activity of inhibiting the expression of iNOS. The enhancer can be used as a BCL-XL expression enhancer, a survivin expression enhancer, a P53 expression enhancer, an SOD expression enhancer, an HO-1 expression enhancer, or an inhibitor of the expression of iNOS that has an oxidative stress stimulating activity.

Priority: JP20110214456 Applic. Date: 2011-09-29

Inventor: TAKITA MASAO [JP]


Publication No.: WO2013047923A1  Published: 04/Apr/2013

Title: NANOEMULSION CONTAINING A POLYASPARTIC ACID DERIVATIVE AND PERSONAL CARE COMPOSITION CONTAINING SAME

Applicant/Assignee: COSMECAKOREA CO., LTD

Application No.: WO2011KR07162 (PCT/KR2011/07162)   Filing Date: 28/Sep/2011

Abstract:

The present invention relates to a nanoemulsion comprising 1-20 parts by weight of polyaspartic acid derivative, 1-5 parts by weight of saturated lecithin, 1-10 parts by weight of dissolution aid, 0.1-5 parts by weight of rhizonlecithin, and 1-5 parts by weight of sucrose fatty acid ester, and also relates to a personal care composition containing said nanoemulsion. The personal care composition containing the nanoemulsion of the present invention can induce biosynthesis of collagen, and has very good inhibitory effects against MMP-1 (matrix metalloproteinase-1) and has anti-allergic effects.

Priority: WO2011KR07162 Applic. Date: 2011-09-28

Inventor: PARK SUNKI [KR]; OH SUNTACK [KR]; LEE CHONGKIL [KR]; JI HONGGEUN [KR]; YU HYOGYEONG [KR]; JEON BONGJU [KR]


Publication No.: WO2013048145A2  Published: 04/Apr/2013

Title: COMPOSITION FOR PREVENTING OR TREATING INFLAMMATORY DISEASES OR DISEASES RELATED TO BONE MASS REDUCTION, CONTAINING 6-(3-HYDROXYPHENYL)-2-NAPHTHOL OR PHARMACEUTICALLY ACCEPTABLE SALT THEREOF AS ACTIVE INGREDIENT

Applicant/Assignee: PUSAN NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION FOUNDATION

Application No.: WO2012KR07824 (PCT/KR2012/07824)   Filing Date: 27/Sep/2012

Abstract:

The present invention relates to a composition for preventing or treating inflammatory diseases or diseases related to bone mass reduction, containing 6-(3-hydroxyphenyl)-2-naphthol or a pharmaceutically acceptable salt thereof as an active ingredient. The 6-(3-hydroxyphenyl)-2-naphthol of the present invention inhibits the generation of proinflammatory cytokine in synoviocytes, reduces the rate of arthritis progression and the clinical disease index of arthritis in an animal model with arthritis, suppresses the loss and deformation of cartilage and bone, and alleviates the degree of inflammation of synovial tissue, the extent of bone erosion, the extent of chondrocyte destruction and the infiltration of immunocytes, and thus can be used as a composition for preventing or treating inflammatory diseases including arthritis.

In addition, the 6-(3-hydroxyphenyl)-2-naphthol of the present invention inhibits the formation of osteoclasts, reduces bone resorption, suppresses the bone loss in an animal model with LPS-induced bone resorption, and improves trabecular bone volume, trabecular bone thickness, trabecular bone number, trabecular space area and the like in an ovariectomized animal model, and thus can be used as a composition for preventing or treating diseases related to bone mass reduction including osteoporosis.

Priority: KR20110099721 Applic. Date: 2011-09-30; KR20120035506 Applic. Date: 2012-04-05

Inventor: MIN DO SIK [KR]; YOO HYUN JUNG [KR]; SUH HONG SUK [KR]; KANG DONG WOO [KR]; PARK SUNG HWAN [KR]


Publication No.: WO2013048334A1  Published: 04/Apr/2013

Title: SMALL MOLECULES FOR EXTENDING THE WELL BEING OF CELLS AND METHODS OF USE THEREOF

Applicant/Assignee: NANYANG POLYTECHNIC

Application No.: WO2011SG00332 (PCT/SG2011/00332)   Filing Date: 26/Sep/2011

Abstract:

The present invention relates to use of a series of compounds and compositions comprising the same for enhancing telomerase expression and/or activating telomerase activity in a cell or tissue of a subject and for treatment of diseases, disorders and/or conditions capable of being affected by enhanced telomerase expression and/or telomerase activation.

Priority: WO2011SG00332 Applic. Date: 2011-09-26

Inventor: SENG ENG KHUAN [SG]


Publication No.: WO2013048787A1  Published: 04/Apr/2013

Title: NOVEL HEMOSTATIC COMPOSITIONS AND DRESSINGS FOR BLEEDING

Applicant/Assignee: YES, INC, THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK

Application No.: WO2012US55518 (PCT/US2012/55518)   Filing Date: 14/Sep/2012

Abstract:

The present invention provides hemostatic compositions comprising components of the flowers of pharmaceutical chamomile (Chamomilla recutita), the leaves of dioecious nettle (Urtica dioica), kaolin, chitosan, fibrinogen and thrombin. Further inclusion of a biocompatible polymeric base, particularly an alignate, generates a composition with superior and broad spectrum hemostatic capabilities, including the ability to arrest arterial hemorrhage. The invention further provides methods of using the inventive compositions in to reduce or stop bleeding, as well as a variety of apparatuses useful in hemostatic contexts that incorporate the inventive compositions. In one particular embodiment, the invention provides hemostatic dressings in which a polymeric layer incorporating chamomile, nettle, kaolin, chitosan, fibrinogen and thrombin components is applied to a textile or fabric material, for example a non-woven viscose.

Priority: US201161539353P Applic. Date: 2011-09-26

Inventor: BACCHETTA MATTHEW D [US]; EASTWOOD LINDA [US]; SINCLAIR JAMES M [US]; COONS HAROLD [US]; SINGH GOPAL [US]


Publication No.: WO2013049272A2  Published: 04/Apr/2013

Title: COMPOSITION AND METHOD FOR TREATMENT OF SYMPTOMS ASSOCIATED WITH VARIOUS SKIN CONDITIONS

Applicant/Assignee: THERACEUTIX, LLC

Application No.: WO2012US57431 (PCT/US2012/57431)   Filing Date: 27/Sep/2012

Abstract:

Compositions containing imidazole-based compounds, and optionally, colloidal oatmeal, for the treatment, prevention, and management of symptoms, conditions, diseases, and disorders of the skin. Also, methods for the treatment, prevention, and management of symptoms, conditions, diseases, and disorders of the skin using compositions containing imidazole-based compounds, and optionally, colloidal oatmeal.

Priority: US201161540953P Applic. Date: 2011-09-29

Inventor: PIPPIN DOUGLAS A [US]


Publication No.: WO2013050529A2  Published: 11/Apr/2013

Title: USE OF IGF-1 IN THE MODULATION OF TREG CELL ACTIVITY AND THE TREATMENT AND PREVENTION OF AUTOIMMUNE DISORDERS OR DISEASES

Applicant/Assignee: EUROPEAN MOLECULAR BIOLOGY LABORATORY

Application No.: WO2012EP69721 (PCT/EP2012/69721)   Filing Date: 05/Oct/2012

Abstract:

The present invention relates to the use of the Insulin-like growth factor-I (IGF-1) in immune modulation and/or in the treatment or prevention of pathogenic or aberrant immune responses or disorders and/or for use in the treatment or prevention of T-cell mediated disorders or diseases and/or for use in the treatment or prevention of diseases where the immune system contributes to the disease state.

Priority: US201161543936P Applic. Date: 2011-10-06

Inventor: BILBAO CORTES DANIEL [IT]; LUCIANI LUISA [US]; ROSENTHAL NADIA [IT]


Publication No.: WO2013050902A1  Published: 11/Apr/2013

Title: JOJOBA OIL HELICHRYSUM EXTRACT AND COMPOSITIONS THEREOF, IN PARTICULAR, FOR TREATING A SKIN CONDITION

Applicant/Assignee:

Application No.: WO2012IB55081 (PCT/IB2012/55081)   Filing Date: 24/Sep/2012

Abstract:

A method for making an extract of a plant of the genus Helichrysum in Jojoba oil or wax, in which a step is provided of joining the Helichrysum, preferably the upper parts of the plant, with a Jojoba wax having an acid number higher than 0.3, in particular higher than 0.32, more in particular higher than 0.36. Such method makes it possible to obtain an extract with a high flavonoid content useful for stimulating the keratinocytes of the epidermis, characterised by a content of Chrysin higher than 80 mg/kg of fatty acids having 20 carbon atoms with one unsaturation, in particular higher than 84 mg/kg, more in particular, higher than 104 mg/kg and/or makes it possible to obtain an extract with a low contained of allergens, characterised by a ratio between the amounts of Limonene and beta- Selinene lower than 0.4, in particular lower than 0.08, more in particular, lower than 0.06. The step of joining is preferably obtained by a dynamic process, for example by percolation or by centrifugation. A medical or cosmetic composition comprising such an extract for treating or preventing a disease and/or a condition that requires a stimulation of cell proliferation of keratinocytes, among which wounds, burns, skin ulcers, scars, skin aging, stretch marks, wrinkles and others. An insect-repellent composition comprising the extract.

Priority: IT2011PI00101 Applic. Date: 2011-09-23

Inventor: DEL CORSO SIMONE [IT]; BIANUCCI ANNA MARIA [IT]; BORGHINI ALICE [IT]; PIETRA DANIELE [IT]


Publication No.: WO2013050959A1  Published: 11/Apr/2013

Title: COMPOSITION FOR THE TREATMENT OF SKIN LESIONS

Applicant/Assignee: FREIA FARMACEUTICI S.R.L

Application No.: WO2012IB55330 (PCT/IB2012/55330)   Filing Date: 04/Oct/2012

Abstract:

A composition is hereby described, comprising virgin oil of Cannabis sativa or a derivative thereof, hyaluronic acid, a salt or derivative thereof, and cosmetically or pharmaceutically acceptable excipients. Specifically, this composition has proved to be particularly suitable for the treatment of the skin both when affected by lesions, by intervening actively in the process of healing, and when subjected to treatment with radiations, by intervening actively in the prevention and reduction in the incidence of radiodermatiti and dermatitis induced from the radiations.

Priority: IT2011MI01806 Applic. Date: 2011-10-05

Inventor: ROVESTI GUIDO [IT]; CAVALIERI MANASSE ALESSANDRO GUIDO [IT]


Publication No.: WO2013052162A1  Published: 11/Apr/2013

Title: CBP/CATENIN ANTAGONISTS FOR ENHANCING ASYMMETRIC DIVISION OF SOMATIC STEM CELLS

Applicant/Assignee: UNIVERSITY OF SOUTHERN CALIFORNIA

Application No.: WO2012US38003 (PCT/US2012/38003)   Filing Date: 15/May/2012

Abstract:

Provided are: composition and methods for: treating aging or an age-related condition, symptom or disease

stimulating hair growth, regrowth or pigmentation (or preventing hair loss)

for increasing the expression of an adenosine receptor in dermal cells (in combination with hair growth)

for treating a condition or disease of the skin or at least one symptom thereof, including cosmetic treatment (e.g., wrinkles, hyperpigmentation, redness, rosacea, dryness, cracking, loss of firmness, loss of elasticity, thinning, and loss of vibrance). The methods comprise administering a sufficient amount of the disclosed CBP/catenin (e.g., CBP/B-catenin) antagonist compositions, and particularly wherein administration is in an amount and manner sufficient to provide for increasing the number of asymmetric renewing divisions relative to, or at the expense of symmetric divisions in relevant somatic stem cell population. In particular aspects, the CBP/catenin (e.g., CBP/B-catenin) antagonist comprises an alkyl and/or fatty acid ester derivative thereof as disclosed herein.

Priority: US201161545033P Applic. Date: 2011-10-07; WO2011US61062 Applic. Date: 2011-11-16

Inventor: KAHN MICHAEL [US]; TEO JIA-LING [US]; MCMILLAN MICHAEL [US]; ZHAO YI [US]; WU YONGFENG [US]


Publication No.: WO2013052508A1  Published: 11/Apr/2013

Title: COMPOUNDS AND COMPOSITIONS FOR MODULATING MELANOGENESIS AND PIGMENTATION ACTIVITIES

Applicant/Assignee: DERMIRA (CANADA), INC

Application No.: WO2012US58496 (PCT/US2012/58496)   Filing Date: 02/Oct/2012

Abstract:

Disclosed herein are pyrazole compounds of formula (Ia) and methods of stimulating melanogenesis or restoring pigmentation by administering to a mammal in need thereof: (The chemical formula should be inserted here.)

Priority: US201161542680P Applic. Date: 2011-10-03

Inventor: HUNT DAVID WILLIAM CAREY [CA]; WINTERS GEOFFREY C [CA]; DAYNARD TIMOTHY SCOTT [CA]; JIANG HUIJUN [CA]; WU JOYCE [CA]


Publication No.: WO2013052647A2  Published: 11/Apr/2013

Title: FORMULATIONS AND USES OF RETINOIC ACID RECEPTOR SELECTIVE AGONISTS

Applicant/Assignee: QURETINO THERAPEUTICS, INC

Application No.: WO2012US58726 (PCT/US2012/58726)   Filing Date: 04/Oct/2012

Abstract:

The invention provides retinoic acid receptor (RAR) selective agonists and formulations thereof for the treatment of disease or for inducing a medically beneficial effect.

Priority: US201113253014 Applic. Date: 2011-10-04

Inventor: MAKRA FERENC [US]


Publication No.: WO2013052820A2  Published: 11/Apr/2013

Title: METHOD OF ACHIEVING IMPROVED HAIR FEEL

Applicant/Assignee: THE PROCTER & GAMBLE COMPANY

Application No.: WO2012US58990 (PCT/US2012/58990)   Filing Date: 05/Oct/2012

Abstract:

A method of achieving improved hair feel. The method comprises applying to hair a composition comprising: (a) a specific cationic guar polymer

(b) a specific cationic copolymer

(c) an anti-dandruff active

(d) a cosmetically acceptable carrier

(e) a surfactant

wherein the weight ratio of (a):(b) is from about 1000:1 to about 3.5:1

and wherein the sum of (a)+(b) is an amount of from about 0.0001% to about 0.7%, by total weight of the composition. The composition forms coacervate particles upon dilution of the composition with water and the coacervate particles have a squeeze flow viscosity of from about 1 cP to about 100 cP. The percentage of coacervate particles with a floc size of greater than about 20 micron is from about 1% to about 60% and the on-scalp deposition of the anti-dandruff active is at least about 1 microgram/cm2.

Priority: US201161544750P Applic. Date: 2011-10-07

Inventor: JOHNSON ERIC SCOTT [US]; STAUDIGEL JAMES ANTHONY [US]; RENOCK SEAN MICHAEL [US]; SCHUBERT BETH ANN [US]; HAMERSKY MARK WILLIAM [US]


Publication No.: WO2013052958A2  Published: 11/Apr/2013

Title: ANTIMICROBIAL COMPOSITIONS AND METHODS EMPLOYING SAME

Applicant/Assignee: MICROBIAL DEFENSE SYSTEMS, LLC, NEXT SCIENCE, LLC

Application No.: WO2012US59263 (PCT/US2012/59263)   Filing Date: 08/Oct/2012

Abstract:

An aqueous composition with a higher-than-neutral pH includes a significant amount of one or more surfactants and large amounts of osmotically active solutes. This composition, as well as an acidic counterpart and solid materials, can be used in a variety of applications such as wound care, oral care, medical equipment reprocessing, healthcare acquired infection and implant treatment.

Priority: US201161545108P Applic. Date: 2011-10-08; US201261660649P Applic. Date: 2012-06-15

Inventor: MYNTTI MATTHEW F [US]


Publication No.: WO2013053021A1  Published: 18/Apr/2013

Title: ANTIBODIES TO CD1d

Applicant/Assignee: CEPHALON AUSTRALIA PTY LTD

Application No.: WO2012AU01247 (PCT/AU2012/01247)   Filing Date: 15/Oct/2012

Abstract:

The present invention provides isolated antibodies or antigen binding portions thereof which bind to CD1d. These antibodies and antigen binding portions thereof have application in treatment of conditions involving NKT cell effector function.

Priority: AU20110904190 Applic. Date: 2011-10-14; US201161547307P Applic. Date: 2011-10-14

Inventor: NAMBIAR JONATHAN KANNAN [AU]; POULTON LYNN DOROTHY [AU]; CLARKE ADAM [AU]; POW ANDREW JAMES [AU]; TAMVAKIS DEBRA [AU]; KOPSIDAS GEORGE [AU]; DOYLE ANTHONY GERARD [AU]; POLLARD MATTHEW [AU]; MUSTAFA HUSEYIN [AU]


Publication No.: WO2013053819A1  Published: 18/Apr/2013

Title: EXON SKIPPING THERAPY FOR DYSTROPHIC EPIDERMOLYSIS BULLOSA

Applicant/Assignee: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE)

Application No.: WO2012EP70154 (PCT/EP2012/70154)   Filing Date: 11/Oct/2012

Abstract:

The present invention also relates to an antisense oligonucleotide complementary to a nucleic acid sequence of COL7A1 gene that is necessary for correct splicing of one or more exons which encode amino acid sequence of type VII collagen implicated in dysfunction of a mutated type VII collagen wherein said exons are selected from the group consisting of exon 73, 74 or 80 of the COL7A1 gene. The present invention also relates to a method for the treatment of a patient suffering from Dystrophic Epidermolysis Bullosa caused by a dysfunction of a mutated type VII collagen, comprising the step of administering to said patient a least one antisense oligonucleotide according to the invention.

Priority: EP20110306316 Applic. Date: 2011-10-11

Inventor: HOVNANIAN ALAIN [FR]; TITEUX MATTHIAS [FR]; TURCZYNSKI SANDRINA [FR]


Publication No.: WO2013054267A1  Published: 18/Apr/2013

Title: SYNERGISTIC COMPOSITION FOR PREVENTING AND TREATING DISORDERS CONNECTED WITH AGEING

Applicant/Assignee: MEDESTEA BIOTECH S.P.A

Application No.: WO2012IB55476 (PCT/IB2012/55476)   Filing Date: 10/Oct/2012

Abstract:

Pharmaceutical or dietary supplement composition, comprising, as active ingredients with combined or synergistic effect, curcumin and astaxanthin, for use in the prevention and treatment of disorders connected with ageing of the organism.

Priority: IT2011TO00901 Applic. Date: 2011-10-10

Inventor: MERIZZI GIULIA FEDERICA [IT]


Publication No.: WO2013054304A1  Published: 18/Apr/2013

Title: USE OF AN ORAL COMPOSITION INCLUDING A MIXTURE OF A LEAST ONE POLYPHENOL, ZINC, AND VITAMIN C

Applicant/Assignee: LABORATOIRES INNEOV

Application No.: WO2012IB55551 (PCT/IB2012/55551)   Filing Date: 12/Oct/2012

Abstract:

The present invention relates to the cosmetic use, as a soothing agent, of an oral composition including at least: (i) a polyphenol or a mixture of polyphenols

(ii) zinc, preferably in the form of a zinc salt

and (iii) vitamin C.

Priority: FR20110059328 Applic. Date: 2011-10-14

Inventor: PICCARDI NATHALIE [FR]; BRU CAROLE [FR]; MAHE YANN [FR]; CHENITI AHSENE [FR]


Publication No.: WO2013054809A1  Published: 18/Apr/2013

Title: EXTERNAL PREPARATION FOR SKIN

Applicant/Assignee: TAISHO PHARMACEUTICAL CO., LTD

Application No.: WO2012JP76190 (PCT/JP2012/76190)   Filing Date: 10/Oct/2012

Abstract:

This external preparation for skin has increased percutaneous absorption characteristics of taurine, and is characterized by containing taurine and at least one of either diisopropyl adipate or diisopropyl sebacate.

Priority: JP20110226566 Applic. Date: 2011-10-14

Inventor: MATSUDO YUKIKO [JP]; NISHIMOTO CHIAKI [JP]; INOUE MARIKO [JP]


Publication No.: WO2013055315A1  Published: 18/Apr/2013

Title: METHOD AND COMPOSITIONS FOR TREATING SKIN

Applicant/Assignee: ELC MANAGEMENT LLC

Application No.: WO2011US55676 (PCT/US2011/55676)   Filing Date: 11/Oct/2011

Abstract:

A method for increasing and/or synchronizing per1 gene expression in skin cells having decreased, irregular, or asynchronous per1 gene expression comprising treating the skin cells with an effective amount of cichoric acid, and the resulting compositions.

Priority: WO2011US55676 Applic. Date: 2011-10-11

Inventor: PELLE EDWARD DR [US]; PERNODET NADINE A [US]; YAROSH DANIEL B [US]


Publication No.: WO2013056147A1  Published: 18/Apr/2013

Title: TOPICAL FORMULATIONS OF CHEMERIN C15 PEPTIDES FOR THE TREATMENT OF DERMATOLOGICAL CONDITIONS

Applicant/Assignee:

Application No.: WO2012US60093 (PCT/US2012/60093)   Filing Date: 12/Oct/2012

Abstract:

Described herein, are topical formulations for treating a dermato logical disease, disorder, or condition. Topical formulation disclosed herein include a therapeutically-effective amount of a human chemerin C15 peptide formulated for dermal administration.

Priority: US201161546833P Applic. Date: 2011-10-13

Inventor: GADEK THOMAS [US]


Publication No.: WO2013056264A2  Published: 18/Apr/2013

Title: SYSTEMS AND METHODS FOR PREDICTING RESPONSE TO ANTI-ANDROGEN THERAPY FOR THE TREATMENT OF ANDROGENETIC ALOPECIA

Applicant/Assignee: FOLLEA INTERNATIONAL LIMITED

Application No.: WO2012US60321 (PCT/US2012/60321)   Filing Date: 15/Oct/2012

Abstract:

Priority: US201161547654P Applic. Date: 2011-10-14

Inventor: GOREN ANDY OFER [US]; MCCOY JOHN [US]


Publication No.: WO2013056453A1  Published: 25/Apr/2013

Title: PREPARATION METHOD AND APPLICATION OF INJECTION FOR NEEDLELESS INJECTION

Applicant/Assignee: 302 MILITARY HOSPITAL OF CHINA

Application No.: WO2011CN81064 (PCT/CN2011/81064)   Filing Date: 20/Oct/2011

Abstract:

An injection for needleless injection, in the form of powder, comprises a biological product and an inorganic salt with water of crystallization removed, a mass ratio of the biological product to the inorganic salt being 1:20 to 1:80. The powder is solid particles formed of the biological product wrapped by an external surface of the inorganic salt with water of crystallization removed. The particle diameter of the powder is 20 to 200 micrometers, and preferably, 50 to 70 micrometers. The injection of the present invention may also comprise a tackifier or a Chinese medicinal adjuvant. The mass ratio of the biological product to the tackifier or Chinese medicinal adjuvant to the inorganic salt with water of crystallization removed is 1:0.2:20 to 1:10:80. Also disclosed are a preparation method of the injection for needleless injection, applications of the injection in preparing medicine for preventing or curing diseases, and a method for performing needleless injection by using the injection.

Priority: WO2011CN81064 Applic. Date: 2011-10-20

Inventor: WANG JIABO [CN]; XIAO XIAOHE [CN]; LI QI [CN]


Publication No.: WO2013056514A1  Published: 25/Apr/2013

Title: RHIZOMA ARISAEMATIS EXTRACTS AND USES THEREOF FOR WOUND-HEALING EFFECTS

Applicant/Assignee: THE HONG KONG UNIVERSITY OF SCIENCE AND TECHNOLOGY

Application No.: WO2012CN01399 (PCT/CN2012/01399)   Filing Date: 18/Oct/2012

Abstract:

Provided are water and alcohol extracts of Rhizoma arisaematis, compounds isolated from Rhizoma arisaematis (such as 3-O-(9,12-octadecadienoyl)-glyceryl-beta-D-galactopyranoside, N-(beta-D-ribofuranos-1-yl)-phenylalanine, and adenosine), pharmaceutical compositions comprising the aforementioned ingredients, as well as uses thereof for promoting wound healing. In one embodiment, the pharmaceutical composition is a topical formulation, such as a cream, ointment, foam, lotion, plaster, gel, and emulsion.

Priority: US201161627772P Applic. Date: 2011-10-18

Inventor: IP NANCY YUK YU [CN]; IP FANNY CHUI FUN [CN]; GUO SHENGJUN [CN]; NG YU PONG [CN]


Publication No.: WO2013056684A2  Published: 25/Apr/2013

Title: THIAZOLE DERIVATIVE AS DHODH INHIBITOR AND USE THEREOF

Applicant/Assignee: EAST CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY

Application No.: WO2012CN86816 (PCT/CN2012/86816)   Filing Date: 18/Dec/2012

Abstract:

The present invention relates to a thiazole derivative, as represented in formula I, as a DHODH inhibitor and a use thereof. The compound of the present invention can be used for treating or preventing DHODH-mediated diseases, including, but not limited to, rheumatoid arthritis and autoimmune diseases such as anti-tumor, anti-organ transplant rejection, and anti-psoriasis.

Priority: CN20111317124 Applic. Date: 2011-10-18

Inventor: ZHAO ZHENJIANG [CN]; HUANG JIN [CN]; LI HONGLIN [CN]; XU YUFANG [CN]; ZHU LILI [CN]; HAN LE [CN]; XU MINGHAO [CN]; GAO RUI [CN]; DIAO YANYAN [CN]; ZHU JUNSHENG [CN]; CAO XIANWEN [CN]; CUI KUNQIANG [CN]


Publication No.: WO2013057183A1  Published: 25/Apr/2013

Title: COMPOSITIONS FOR CONTROLLING VASCULARIZATION IN OPHTHALMOLOGICAL AND DERMATOLOGICAL DISEASES

Applicant/Assignee: AVIENNE PHARMACEUTICALS GMBH

Application No.: WO2012EP70645 (PCT/EP2012/70645)   Filing Date: 18/Oct/2012

Abstract:

A treatment method for controlling vascularization in a patient's eye or skin includes administering to the patient's eye or skin a pharmaceutical composition having formula (I) or a pharmaceutically acceptable salt, hydrate, enantiomer, diastereomer, racemate or mixtures of stereoisomers thereof. wherein the patient has a disease or disorder associated with vascularization in the eye or skin or wherein said patient is at risk for developing a disease or disorder associated with vascularization of the eye or skin.

Priority: US201161549617P Applic. Date: 2011-10-20

Inventor: JANSEN BURKHARD [AT]


Publication No.: WO2013057284A1  Published: 25/Apr/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING DGLA, 15-OHEPA, AND/OR 15-HETRE AND METHODS OF USE THEREOF

Applicant/Assignee: DIGNITY SCIENCES LIMITED

Application No.: WO2012EP70809 (PCT/EP2012/70809)   Filing Date: 19/Oct/2012

Abstract:

The present disclosure provides compositions comprising fatty acids, or derivatives thereof (e.g., C1-C4 esters) including, for example, DGLA, 15-OHEPA and/or 15-HETrE, used singly or in combination with anti-bacterial agents for the treatment of disease and/or disorders such as acne or atopic dermatitis.

Priority: US201161549018P Applic. Date: 2011-10-19

Inventor: CLIMAX JOHN [IE]; COUGHLAN DAVID [IE]; MANKU MEHAR [GB]


Publication No.: WO2013057287A1  Published: 25/Apr/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING DGLA AND/OR 15-HETRE AND METHODS OF USE THEREOF

Applicant/Assignee: DIGNITY SCIENCES LIMITED

Application No.: WO2012EP70813 (PCT/EP2012/70813)   Filing Date: 19/Oct/2012

Abstract:

The present disclosure provides compositions comprising fatty acids, or derivatives thereof (e.g., C1-C4 esters) including, for example, DGLA, and/or 15-HETrE, used singly or in combination for the prevention and/or treatment of effects associated with UV radiation such as erythema.

Priority: US201161549022P Applic. Date: 2011-10-19

Inventor: CLIMAX JOHN [IE]; COUGHLAN DAVID [IE]; MANKU MEHAR [GB]


Publication No.: WO2013057455A2  Published: 25/Apr/2013

Title: COSMETIC OR DERMATOLOGICAL COMPOSITION COMPRISING ALKYL POLYPENTOSIDE VESICLES, AND METHOD FOR PREPARING SAME

Applicant/Assignee: LVMH RECHERCHE

Application No.: WO2012FR52403 (PCT/FR2012/52403)   Filing Date: 19/Oct/2012

Abstract:

The subject matter of the present invention is a cosmetic or dermatological composition comprising a continuous aqueous phase in which are dispersed vesicles based on at least one alkyl polypentoside, and also comprising at least one alcohol and at least one surfactant. More specifically, the cosmetic or dermatological composition comprises at least one cosmetic or dermatological active agent and at least one continuous aqueous phase in which vesicles are dispersed, - wherein said vesicles comprise at least one alkyl polypentoside obtained by reaction of a pentose and of at least a first fatty alcohol and a second fatty alcohol comprising a different number of carbon atoms ranging from 10 to 12, wherein said polypentoside has an average degree of polymerization of less than or equal to 2, - and wherein said composition also comprises at least one surfactant with an HLB of less than 10, and at least one alcohol having from 1 to 5 carbon atoms. The present invention also relates to a method for preparing the composition, which consists in bringing a mixture comprising alkyl polypentoside, the surfactant and the alcohol into contact with an aqueous phase with stirring.

Priority: FR20110059507 Applic. Date: 2011-10-20

Inventor: PICHOT ANGELIQUE [FR]; ALARD VALERIE [FR]; POUGET THIERRY [FR]; SCATTARELLI DOMINIQUE [FR]; ERNENWEIN CEDRIC [FR]; ESTRINE BORIS [FR]


Publication No.: WO2013058303A1  Published: 25/Apr/2013

Title: MEDICINAL COMPOSITION

Applicant/Assignee: RAQUALIA PHARMA INC

Application No.: WO2012JP76899 (PCT/JP2012/76899)   Filing Date: 18/Oct/2012

Abstract:

The present invention provides a medicinal composition capable of preventing a decrease in the blood exposure level of a third generation coxib drug, a method for preparing the composition and utilization of the same. It was discovered that, by adding a basic amine or a basic amino acid or cyclodextrin to a third generation coxib compound, a medicinal composition capable of inhibiting a decrease in the blood concentration thereof, a decrease in the area under concentration thereof and a decrease in the bioavailability thereof can be obtained. In addition, the medicinal composition according to the present invention is highly stable and useful as a medicine. That is, a technical idea that a decrease in blood concentration, a decrease in area under concentration and a decrease in bioavailability can be inhibited by adding a basic amine or a basic amino acid or cyclodextrin is thus established.

Priority: JP20110228846 Applic. Date: 2011-10-18

Inventor: IWATA YASUHIRO [JP]; SHIMADA KAORU [JP]; OKUMURA YOSHIYUKI [JP]; KASHINO MAYUMI [JP]; YOSHIDA HIROMITSU [JP]


Publication No.: WO2013059203A1  Published: 25/Apr/2013

Title: NOVEL MODIFIED CURCUMINS AND THEIR USES

Applicant/Assignee: THE RESEARCH FOUNDATION OF STATE UNIVERSITY OF NEW YORK, CHEM-MASTER INTERNATIONAL, INC

Application No.: WO2012US60437 (PCT/US2012/60437)   Filing Date: 16/Oct/2012

Abstract:

This invention provides a compound having the structure (I) wherein alpha, beta, A, B, and R1-R4 are defined herein. This invention also provides pharmaceutical compositions comprising the above compounds, a method of accelerating the healing of a wound, a method of inhibiting the activity and/or levels of a matrix metalloproteinase (MMP), a method of inhibiting the production of a cytokine in a population of cells, a method of inhibiting the production of a growth factor in a population of cells, and a method of inhibiting NFK-B activation in a population of cells.

Priority: US201161548035P Applic. Date: 2011-10-17

Inventor: GOLUB LOME M [US]; LEE HSI-MING [US]; JOHNSON FRANCIS [US]


Publication No.: WO2013059942A1  Published: 02/May/2013

Title: USE OF A GINSENG EXTRACT TO PREVENT AND TREAT ALOPECIA AREATA

Applicant/Assignee: AFEXA LIFE SCIENCES INC

Application No.: WO2012CA50765 (PCT/CA2012/50765)   Filing Date: 26/Oct/2012

Abstract:

Ginseng extracts as well as preparations such as medicaments, pharmaceuticals and food or dietary supplements for use to treat or prevent alopecia areata in subjects requiring such treatment or prevention are provided. The ginseng extract is a carbohydrate extract that contains between about 60-70 wt% carbohydrates, for example.

Priority: US201161552916P Applic. Date: 2011-10-28

Inventor: SHAN JACQUELINE [CA]; MILLER SANDRA [CA]; DURAIRAJ PUNITHAVATHI [CA]


Publication No.: WO2013060303A1  Published: 02/May/2013

Title: POLYPEPTIDES INHIBITING NEOVASCULARIZATION AND USES THEREOF

Applicant/Assignee: SHANGHAI FIRST PEOPLE'S HOSPITAL

Application No.: WO2012CN83671 (PCT/CN2012/83671)   Filing Date: 29/Oct/2012

Abstract:

Provided are polypeptides for inhibiting angiogenic activity, the source of said polypeptides being placental growth factor-1. Also provided are derivatives of the polypeptides, nucleic acid molecules for encoding same, a pharmaceutical composition containing the polypeptides, and uses of the polypeptides in the preparation of medications related to neovascularization disease.

Priority: CN20111335251 Applic. Date: 2011-10-28

Inventor: XU XUN [CN]; ZHENG YING [CN]


Publication No.: WO2013060964A1  Published: 02/May/2013

Title: NOVEL ESTERS OF N-ACYL DERIVATIVES OF AMINO ACIDS AND DIOLS, METHOD FOR PREPARING SAME, AND USE THEREOF IN COSMETICS AND AS A DRUG

Applicant/Assignee: SOCIETE D'EXPLOITATION DE PRODUITS POUR LES INDUSTRIES CHIMIQUES SEPPIC

Application No.: WO2012FR52324 (PCT/FR2012/52324)   Filing Date: 12/Oct/2012

Abstract:

The invention relates to a compound of formula (I): R'-O-A-O-R'', in which R' and R" are a hydrogen atom or a monovalent radical of formula (IIa), or a monovalent radical of formula (IIb), it being understood that at least one of the radicals R' or R" is not a hydrogen atom and that, when none of the radicals R' and R" is a hydrogen atom, R' and R" are identical, and in which A is a divalent radical of formula (III): -CH(X1)-[C(X2)(X3)]p-CH(X4) in which X1, X2, X3 and X4 are identical or different and are either a hydrogen atom or a methyl radical or an ethyl radical, and p is an integer greater than or equal to 1 and less than or equal to 6. The invention also relates to the method for preparing said compound and to the use thereof in cosmetics and as a drug.

Priority: FR20110059762 Applic. Date: 2011-10-27

Inventor: DUMONT SANDY [FR]; GUILBOT JEROME [FR]; GARCEL STEPHANIE [FR]; CATTUZZATO LAETITIA [FR]


Publication No.: WO2013061004A1  Published: 02/May/2013

Title: NOVEL DISUBSTITUTED 3,4-DIAMINO-3-CYCLOBUTENE-1,2-DIONE COMPOUNDS FOR USE IN THE TREATMENT OF CHEMOKINE-MEDIATED DISEASES

Applicant/Assignee: GALDERMA RESEARCH & DEVELOPMENT

Application No.: WO2012FR52478 (PCT/FR2012/52478)   Filing Date: 26/Oct/2012

Abstract:

The present invention relates to novel disubstituted 3,4-diamino-3-cyclobutene-1,2-dione compounds corresponding to the following general formula (I): , to the pharmaceutical compositions containing these compounds and also to the use of these compounds and of these compositions for the treatment of chemokine-mediated diseases.

Priority: US201161552940P Applic. Date: 2011-10-28; FR20110059833 Applic. Date: 2011-10-28

Inventor: MUSICKI BRANISLAV [FR]; AUBERT JEROME [FR]; BOITEAUX JEAN-GUY [FR]; CLARY LAURENCE [FR]; ROSSIO PATRICIA [FR]; SCHUPPLI-NOLLET MARLENE [FR]


Publication No.: WO2013061005A1  Published: 02/May/2013

Title: DISUBSTITUTED 3,4-DIAMINO-3-CYCLOBUTENE-1,2-DIONE COMPOUNDS FOR USE IN THE TREATMENT OF CHEMOKINE-MEDIATED PATHOLOGIES

Applicant/Assignee: GALDERMA RESEARCH & DEVELOPMENT

Application No.: WO2012FR52479 (PCT/FR2012/52479)   Filing Date: 26/Oct/2012

Abstract:

The present invention relates to novel disubstituted 3,4-diamino-3-cyclobutene-1,2-dione compounds, represented by the following general formula (I): the pharmaceutical compositions containing these compounds and the use of these compounds and these compositions for the treatment of chemokine-mediated pathologies.

Priority: US201161552829P Applic. Date: 2011-10-28; FR20110059829 Applic. Date: 2011-10-28

Inventor: MUSICKI BRANISLAV [FR]; AUBERT JEROME [FR]; BOITEAU JEAN-GUY [FR]; CLARY LAURENCE [FR]; ROSSIO PATRICIA [FR]; SCHUPPLI-NOLLET MARLENE [FR]


Publication No.: WO2013061106A1  Published: 02/May/2013

Title: MODIFIED PEPTIDE TOXINS

Applicant/Assignee: UNIVERSITY OF DEBRECEN, UNIVERSITY OF SZEGED

Application No.: WO2012HU00117 (PCT/HU2012/00117)   Filing Date: 29/Oct/2012

Abstract:

The invention relates to toxin peptides capable of selectively inhibiting a Kv1.3 potassium channel protein. The toxin peptides of the invention are modified anuroctonus scorpion toxin peptides..

Priority: HU20110000604 Applic. Date: 2011-10-28

Inventor: VARGA ZOLTAN [HU]; PANYI GYOERGY [HU]; TOTH GABOR [HU]; RAKOSI KINGA [HU]


Publication No.: WO2013061455A1  Published: 02/May/2013

Title: NOVEL RESVERATROL POLYMERIZATION COMPOUND OR PHARMACEUTICALLY ACCEPTABLE SALT THEREOF

Applicant/Assignee: UHA MIKAKUTO CO., LTD

Application No.: WO2011JP74870 (PCT/JP2011/74870)   Filing Date: 27/Oct/2011

Abstract:

The present invention relates to: a resveratrol polymerization compound represented by formula (1) (wherein R1 and R2 independently represent -OH or a group represented by formula (i), wherein R1 and R2 are different from each other) or a pharmaceutically acceptable salt thereof

and an anti-cancer agent, an anti-cancer agent for oral cancer, an anti-oxidative agent, an anti-bacterial agent, a lipase inhibitor, an anti-obesity agent, a therapeutic agent for skin diseases, a food, a medicinal agent, a quasi drug or a cosmetic which comprises at least one compound selected from the group consisting of the resveratrol polymerization compound and pharmaceutically acceptable salts thereof.

Priority: WO2011JP74870 Applic. Date: 2011-10-27

Inventor: KISHI AKINOBU [JP]; DOI SATOSHI [JP]; MATSUKAWA TAIJI [JP]; MATSUI TAKEKI [JP]; YAMADA YASUMASA [JP]; YAMADA ICHIRO [JP]


Publication No.: WO2013061977A1  Published: 02/May/2013

Title: HETEROCYCLE DERIVATIVE HAVING PGD2 RECEPTOR ANTAGONIST ACTIVITY

Applicant/Assignee: SHIONOGI & CO., LTD

Application No.: WO2012JP77393 (PCT/JP2012/77393)   Filing Date: 24/Oct/2012

Abstract:

The present invention pertains to the compound represented by formula (I) (in the formula: X1, X2, X3, X4, X5, R5, R6, R7, R8, n, p, q, ring A, and ring B have the same meaning as the definitions described in the description) or a pharmaceutically acceptable salt thereof.

Priority: JP20110233965 Applic. Date: 2011-10-25

Inventor: HATA KAYOKO [JP]; MASUDA MANAMI [JP]; NAKAI HIROMI [JP]; TANIYAMA DAISUKE [JP]; TOBINAGA HIROYUKI [JP]; HATO YOSHIO [JP]; FUJIU MOTOHIRO [JP]


Publication No.: WO2013062027A1  Published: 02/May/2013

Title: AZOLE DERIVATIVE

Applicant/Assignee: TAISHO PHARMACEUTICAL CO., LTD

Application No.: WO2012JP77541 (PCT/JP2012/77541)   Filing Date: 25/Oct/2012

Abstract:

The invention according to the present application provides a therapeutic or prophylactic agent for diseases including mood disorders, anxiety disorders, schizophrenia, Alzheimer's disease, Parkinson's disease, Huntington's chorea, eating disorder, hypertension, digestive diseases, drug dependence, epilepsy, cerebral infarction, cerebral ischemia, cerebral edema, head injury, inflammations, immune-related diseases and alopecia. Specifically provided is an azole derivative having an arginine-vasopressin 1b receptor antagonistic activity and represented by general formula (I) or a pharmaceutically acceptable salt thereof.

Priority: JP20110236487 Applic. Date: 2011-10-27

Inventor: YOSHINAGA MITSUKANE [JP]; KUWADA TAKESHI [JP]; MIYAKOSHI NAOKI [JP]; ISHIZAKA TOMOKO [JP]; WAKASUGI DAISUKE [JP]; SHIROKAWA SHIN-ICHI [JP]; HATTORI NOBUTAKA [JP]; SHIMAZAKI YOUICHI [JP]


Publication No.: WO2013062190A1  Published: 02/May/2013

Title: COOLING COMPOSITION

Applicant/Assignee:

Application No.: WO2012KR02917 (PCT/KR2012/02917)   Filing Date: 17/Apr/2012

Abstract:

The present invention relates to a cooling composition which allows for cooling and a cooling sensation to last for a long time without harming the skin and provides deodorizing and sterilization effects while being provided to the skin, scalp, or even clothing directly contacting skin. The cooling composition according to the present invention contains an endothermic cooling ingredient, a cooling and deodorizing ingredient, and an anti-skin cancer ingredient. The endothermic cooling ingredient includes at least one selected from the group consisting of erythritol, xylitol, maltitol, mannitol, isomalt, stevioside, thaumatin, D-xylose, D-ribose, and L-sorbose, the cooling and deodorizing ingredient includes at least one selected from the group consisting of sorbitol, terpene, camphor, and flavonoid, and the anti-skin cancer ingredient includes at least one selected from the group consisting of a cabbage extract, a broccoli extract, a cauliflower extract, a kale extract, an arugula extract, a collards extract, a kohlrabi extract, a turnip extract, a red radish extract, a watercress extract, a garlic extract, a ginseng extract, a green tea extract, and an oleoresin turmeric extract.

Priority: KR20110109711 Applic. Date: 2011-10-26

Inventor: JUNG SANG-MIN [KR]


Publication No.: WO2013062266A2  Published: 02/May/2013

Title: WRAP FERMENTATION METHOD USING A MEDICINAL FLOWER, AND COMPOSITION FOR EXTERNAL APPLICATION ONTO THE SKIN USING SAME

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR08541 (PCT/KR2012/08541)   Filing Date: 18/Oct/2012

Abstract:

The present invention relates to a composition for an external application onto the skin, including a wrap fermentation extract using a medicinal flower. More particularly, the present invention relates to a composition for external application onto the skin, including a wrap fermentation extract obtained by fermenting a natural product through covering or wrapping using a medicinal flower, and having excellent antioxidant, anti-aging, whitening, and moisturizing effects on the skin, as well as to a method for preparing same.

Priority: KR20110109287 Applic. Date: 2011-10-25

Inventor: SHIM JIN SUP [KR]; PARK JUN SEONG [KR]; KIM HYUN HEE [KR]; YEOM MYEONG HUN [KR]; CHO JUN CHEOL [KR]


Publication No.: WO2013062333A1  Published: 02/May/2013

Title: COMPOSITION COMPRISING SYRINGARESINOL FOR IMPROVING THE SKIN

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR08816 (PCT/KR2012/08816)   Filing Date: 25/Oct/2012

Abstract:

The present invention relates to a composition for improving the skin, which comprises the compound of chemical formula 1, the derivatives thereof, or the pharmaceutically acceptable salts thereof as active ingredients.

Priority: KR20110110484 Applic. Date: 2011-10-27; KR20110112764 Applic. Date: 2011-11-01

Inventor: SHIN HYUN JUNG [KR]; CHO SI YOUNG [KR]; SEO DAE BANG [KR]; PARK CHAN WOONG [KR]; KIM WAN GI [KR]; LEE SANG JUN [KR]


Publication No.: WO2013062995A1  Published: 02/May/2013

Title: COMPOSITIONS AND METHODS FOR TREATING DEEP PARTIAL AND FULL THICKNESS WOUNDS AND INJURIES

Applicant/Assignee: BIOMIMETIC THERAPEUTICS, INC

Application No.: WO2012US61527 (PCT/US2012/61527)   Filing Date: 24/Oct/2012

Abstract:

The present invention provides compositions and methods for treating deep partial thickness or full thickness wounds or injuries. The present invention also provides compositions and methods for promoting healing and regeneration of impaired or damaged tissue at a site of such partial thickness or full thickness wounds or injuries, as well as promoting vascularization and angiogenesis in regenerating and/or supportive tissue at such sites.

Priority: US201161551362P Applic. Date: 2011-10-25

Inventor: LYNCH SAMUEL EUGENE [US]


Publication No.: WO2013064244A1  Published: 10/May/2013

Title: S100 FAMILY PROTEINS AND THEIR USES

Applicant/Assignee: LUDWIG-MAXIMILIANS-UNIVERSITAET MUENCHEN

Application No.: WO2012EP04546 (PCT/EP2012/04546)   Filing Date: 30/Oct/2012

Abstract:

The present invention relates to S100 family proteins and their uses. Moreover, the present invention relates to pharmaceutical compositions comprising an S100 family protein.

Priority: EP20110008711 Applic. Date: 2011-10-31

Inventor: GAUGLITZ GERD [DE]; WOLF RONALD [DE]


Publication No.: WO2013064445A1  Published: 10/May/2013

Title: IMIDAZOPYRIDAZINE COMPOUNDS

Applicant/Assignee: F. HOFFMANN-LA ROCHE AG

Application No.: WO2012EP71337 (PCT/EP2012/71337)   Filing Date: 29/Oct/2012

Abstract:

The present invention relates to the use of novel compounds of formula (I): wherein all variable substituents are defined as described herein, which are SYK inhibitors and are useful for the treatment of auto-immune and inflammatory diseases.

Priority: WO2011CN81614 Applic. Date: 2011-11-01

Inventor: HERMANN JOHANNES CORNELIUS [US]; KUGLSTATTER ANDREAS [DE]; LUCAS MATTHEW C [US]; PADILLA FERNANDO [US]; WANNER JUTTA [US]; ZHANG XIAOHU [CN]


Publication No.: WO2013064681A1  Published: 10/May/2013

Title: N-(PYRID-4-YL)AMIDES AND N-(PYRIMIDIN-4-YL)AMIDES AND THEIR PHARMACEUTICAL AND COSMETIC USE

Applicant/Assignee: GALDERMA RESEARCH & DEVELOPMENT

Application No.: WO2012EP71811 (PCT/EP2012/71811)   Filing Date: 05/Nov/2012

Abstract:

The present invention relates generally to the field of pharmaceuticals and cosmetics. More specifically, the present invention pertains to certain N-(pyrid-4-yl)amides and N-(pyrimidin-4-yl)amides of formula (1) which are potent modulators (e.g., inhibitors) of an androgen receptor, and which are useful, for example, in therapy, for example, in the treatment of a dermatological disease or disorder

a disease or disorder of the sebaceous gland(s)

acne

hyperseborrhoea

oily skin

seborrhoeic dermatitis

hyperpilosity or hirsutism

atopic dermatitis

or androgenic alopecia

especially acne. The present invention also relates to compositions (e.g., pharmaceutical compositions, cosmetic compositions) comprising the compounds

methods of preparing the compositions

methods of modulating (e.g., inhibiting) an androgen receptor using the compounds and/or compositions

and medical and/or cosmetic use of the compounds and compositions.

Priority: US201161555583P Applic. Date: 2011-11-04; FR20110059997 Applic. Date: 2011-11-04

Inventor: POINSARD CEDRIC [FR]


Publication No.: WO2013065017A2  Published: 10/May/2013

Title: PLATELET RICH PLASMA (PRP) AND PROMININ-1 DERIVED PEPTIDE STIMULATE LYMPHANGIOGENESIS

Applicant/Assignee: CENTRE HOSPITALIER UNIVERSITAIRE VAUDOIS (C.H.U.V.)

Application No.: WO2012IB56110 (PCT/IB2012/56110)   Filing Date: 02/Nov/2012

Abstract:

The present invention relates to an isolated prom-1 peptide derived from a prominin-, a conservative amino acid substitution variant of said prominin-1 peptide, or a fragment of 5 said prominin-1 peptide, as well as to isolated Platelet Rich Plasma (PRP), or a combination of PRP and said prominin-1 peptide for use in the treatment and/or prevention of lymphedema, lymphatic fistula, lymphorrea or lymphocele/seroma formation, any chronic wound not healing because of lymphorrhea or lymph secretions in surgical wounds.

Priority: US201161555098P Applic. Date: 2011-11-03

Inventor: ERBA PAOLO [CH]


Publication No.: WO2013066208A2  Published: 10/May/2013

Title: PHARMACEUTICAL COMPOSITION BASED ON EPIGALLOCATECHIN GALLATE-CONTAINING NANO-MICELLES AND USE THEREOF TO TREAT ATOPIC DERMATITIS, CROHN'S DISEASE, ADENOMYOSIS AND HYPERPLASTIC PROSTATE DISORDERS

Applicant/Assignee: ZAKRYTOYE AKTSIONERNOYE OBSHCHESTVO "VELES FARMA"

Application No.: WO2012RU00625 (PCT/RU2012/00625)   Filing Date: 31/Jul/2012

Abstract:

The invention relates to the field of pharmaceuticals. The aim of the present invention is to produce nano-micellar structures containing EGCG and providing the technical result of improved peroral bioavailability. This aim is achieved by a novel pharmaceutical composition for peroral administration containing epigallocatechin-3-gallate as active ingredient and a special-purpose additive, said special-purpose additive being in the form of an oxyethylene-oxypropylene block copolymer having a hydrophobic block content of less than 50 mass% and a hydrophobic block molecular mass of 2250 daltons or more, wherein the mass ratio of active ingredient to block copolymer is 1:1 - 10:1. The compositions improve the absorption of the active compound in the bloodstream when said active compound is administered perorally.

Priority: RU20110143943 Applic. Date: 2011-10-31

Inventor: KISELEV VSEVOLOD IVANOVICH [RU]; VASILYEVA IRINA GENNADIEVNA [RU]


Publication No.: WO2013066481A2  Published: 10/May/2013

Title: COSMETIC USE OF N-HETEROARYLBISAMIDE ANALOGS AND RELATED COMPOUNDS

Applicant/Assignee: AVON PRODUCTS, INC

Application No.: WO2012US52040 (PCT/US2012/52040)   Filing Date: 23/Aug/2012

Abstract:

Cosmetic and dermatological compositions comprising N-heteroarylbisamide analogs and methods of using such compositions to impart anti-aging benefits to the skin and/or improve skin conditions resulting from reduced collagen and hyaluronic acid production are disclosed. The N-heteroarylbisamides are believed to stimulate collagen and hyaluronic acid production and restore or maintain homeostasis for these compounds.

Priority: US201113285458 Applic. Date: 2011-10-31

Inventor: PARIMOO SATISH [US]; ILAYA NANCY T [US]; LYGA JOHN W [US]


Publication No.: WO2013066623A1  Published: 10/May/2013

Title: Anti Aging Application and Method for Treating Aging

Applicant/Assignee: VASKIN, LLC

Application No.: WO2012US60460 (PCT/US2012/60460)   Filing Date: 16/Oct/2012

Abstract:

There is a topical anti-aging composition which is configured to interfere with the production of tyrosinase, as well as melanin by reacting with melanocytes as well as reacting with, or acting on keratinocytes. The anti-aging composition comprises an emulsion comprising a plurality of active ingredients comprising a plurality of pigmentation reducing elements which are configured to interrupt or prevent the production of tyrosinase and melanin. In addition there are a plurality of antioxidants a plurality of anti wrinkling agents a plurality of anti-inflammatory agents at least one additional agent comprising at least one of an emollient, a proactant and a conditioning agent.

Priority: US201161555289P Applic. Date: 2011-11-03; US201213650940 Applic. Date: 2012-10-12

Inventor: ARSHED KHALEEQ [US]


Publication No.: WO2013067195A1  Published: 10/May/2013

Title: METHODS AND COMPOSITIONS FOR WOUND TREATMENT

Applicant/Assignee: HALSCION, INC

Application No.: WO2012US63083 (PCT/US2012/63083)   Filing Date: 01/Nov/2012

Abstract:

The present invention provides compositions and methods useful in the treatment of wounds, particularly in reducing or preventing scar formation, particularly hypertrophic scarring or keloid formation. The composition includes gelatin having an average molecular mass of about 75,000 Da to about 250,000 Da and a polymeric carbohydrate having an average molecular mass of about 10,000 Da to about 1,000,000 Da. The invention thus further provides methods of treatment, including methods useful in hypertrophic scar or keloid revision as well as prophylactic, scar inhibiting methods.

Priority: US201161554870P Applic. Date: 2011-11-02

Inventor: NGUYEN TIEN [US]; PRUDHOMME KATHLEEN [US]; YAMAMOTO RONALD [US]; LOWE ADAM G [US]; GREEN ANDREW MICHAEL [US]


Publication No.: WO2013067271A2  Published: 10/May/2013

Title: STABLE DERMATOLOGICAL AEROSOL FOAMS UTILIZING REACTIVE PROPELLANTS

Applicant/Assignee: PRECISION DERMATOLOGY, INC

Application No.: WO2012US63188 (PCT/US2012/63188)   Filing Date: 02/Nov/2012

Abstract:

Described herein are chemically-stabile formulations comprising a reactive propellant. The formulations are delivered as an aerosol foam, and are suitable for topical application. The aerosol propellant may be a hydrofluoroolefin propellant. The emulsions or compositions may comprise reactive active agents, such as peroxides, retinoids, or quinones. Also described are methods of treating skin disorders, comprising the step of applying to an affected area of a subject in need thereof a therapeutically-effective amount of an inventive emulsion or aerosol composition.

Priority: US201161555045P Applic. Date: 2011-11-03

Inventor: TRUMBORE MARK W [US]; MAJHI PINAKI RANJAN [US]


Publication No.: WO2013067682A1  Published: 16/May/2013

Title: A HYDROCOLLOID COMPOSITION AND AN ARTICLE CONTAINING THE SAME

Applicant/Assignee: 3M INNOVATIVE PROPERTIES COMPANY

Application No.: WO2011CN81917 (PCT/CN2011/81917)   Filing Date: 08/Nov/2011

Abstract:

The present invention provides a hydrocolloid composition which, based on 100% by weight of the hydrocolloid composition, comprises: 10-90%) by weight of a polyisobutylene tackifier

5-55% by weight of a hydrophilic absorbing substance

and 0.1-20% by weight of a functional ingredient. The invention further provides an article containing the hydrocolloid composition.

Priority: WO2011CN81917 Applic. Date: 2011-11-08

Inventor: FAN TING [CN]; XIE YINGWEI [CN]; HUANG JING [CN]; QIU KAI [CN]; HO GRACE [CN]; WU DONG [CN]; HU JIE [CN]


Publication No.: WO2013067710A1  Published: 16/May/2013

Title: NAMPT INHIBITORS

Applicant/Assignee: ABBOTT LABORATORIES, ABBOTT LABORATORIES TRADING (SHANGHAI) COMPANY, LTD

Application No.: WO2011CN82108 (PCT/CN2011/82108)   Filing Date: 11/Nov/2011

Abstract:

Disclosed are compounds which inhibit the activity of NAMPT, compositions containing the compounds and methods of treating diseases during which NAMPT is expressed.

Priority: WO2011CN82108 Applic. Date: 2011-11-11

Inventor: CURTIN MICHAEL L [US]; VASUDEVAN ANIL [IN]; WOLLER KEVIN R [US]


Publication No.: WO2013068964A1  Published: 16/May/2013

Title: PHARMACEUTICAL COMPOSITION FOR THE PREVENTION AND THE TREATMENT OF DEGENERATIVE SKIN DISORDERS ESPECIALLY CAUSED BY IONIZING RADIATIONS

Applicant/Assignee: SOLOSALE S.R.L

Application No.: WO2012IB56269 (PCT/IB2012/56269)   Filing Date: 08/Nov/2012

Abstract:

It is described a pharmaceutical formulation containing S-acyl derivatives of glutathione with polyunsaturated fatty acids for the prevention and treatment of degenerative skin disorders caused by exposure to ultraviolet radiation from sunlight or artificial source. A process for the industrial synthesis of S-acyl derivatives of glutathione with long-chain fatty acids is also described.

Priority: IT2011PO00021 Applic. Date: 2011-11-08

Inventor: FEDELI ENRICHETTA [IT]; SERNESI ILARIA [IT]


Publication No.: WO2013068966A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING AN UREA OR AMIDE BASED ALPHA-ALKOXYSILANE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56276 (PCT/IB2012/56276)   Filing Date: 09/Nov/2012

Abstract:

The invention relates to a cosmetic composition, in particular a composition for making up and/or caring for keratin materials, preferably a nail makeup, comprising the compound of chemical formula (I) below: (I) in which: m represents an integer equal to 0 or 1

n represents an integer between 2 and 8

R1 represents a group (C1-C20)alkyl or an aryl group, or alternatively, when m is equal to 0, R1 may also represent a carbonyl

R2 and R3 represent an ethoxy group or a group (C1-C20)alkyl, optionally substituted with an amino group

Y represents a polyurea or a polyurethane or alternatively a hydrocarbon-based group comprising from 2 to 100 carbon atoms. The invention also relates to a cosmetic process, in particular a makeup or hair shaping process, preferably a process for making up keratin materials, in particular the nails and/or the hair, characterized in that it comprises at least one step which consists in applying a cosmetic composition as above defined to keratin materials.

Priority: FR20110060225 Applic. Date: 2011-11-09; US201161565523P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]


Publication No.: WO2013068967A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING AN ALPHA-ALKOXYSILANE OBTAINED FROM AN ACRYLATE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56278 (PCT/IB2012/56278)   Filing Date: 09/Nov/2012

Abstract:

The invention relates to a cosmetic composition, in particular a composition for making up and/or caring for keratin materials, preferably a nail makeup, comprising the compound of chemical formula (I) below: (I) in which: n is between 1 and 8, m is between 1 and 20, m' is equal to 0 or 1, R1 represents a hydrogen atom or a methyl group, R2 and R2' independently represent a hydrogen atom or a group (C1-C20)alkyl or an aryl group, or alternatively R2 and R2' are linked to form a (C1-C6) alkylene chain, R3 and R4 independently represent an ethoxy group, a group (C1-C20)alkyl or a (C1-C4)aminoalkyl group, Y represents a polyether or a polyester or a polyurethane or a polyurea, or alternatively a hydrocarbon-based group comprising from 2 to 1500 carbon atoms. The invention also relates to a cosmetic process, in particular a makeup or hair shaping process, preferably a process for making up keratin materials, in particular the nails and/or the hair, characterized in that it comprises at least one step which consists in applying a cosmetic composition as above defined to keratin materials.

Priority: FR20110060222 Applic. Date: 2011-11-09; US201161565515P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]


Publication No.: WO2013068968A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING AN ALPHA-ALKOXYSILANE OBTAINED FROM AN EPOXIDE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56279 (PCT/IB2012/56279)   Filing Date: 09/Nov/2012

Abstract:

The invention relates to a cosmetic composition, in particular a composition for making up and/or caring for keratin materials, preferably a nail makeup, comprising the compound of chemical formula (I) below: (I) in which n represents an integer between 1 and 8

X represents an oxygen atom or a nitrogen atom substituted with a group R1

R1 represents a hydrogen atom or a group (C1-C20)alkyl or alternatively an aryl group

R2 and R3 independently represent an ethoxy group or a group (C1-C20)alkyl optionally substituted with an amino group

Y represents a polyether or a polyester or a polyurethane or a polyurea, or alternatively a hydrocarbon- based group comprising from 2 to 1500 carbon atoms. The invention also relates to a cosmetic process, in particular a makeup or hair shaping process, preferably a process for making up keratin materials, in particular the nails and/or the hair, characterized in that it comprises at least one step which consists in applying a cosmetic composition as above defined.

Priority: FR20110060211 Applic. Date: 2011-11-09; US201161565522P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]; LAGRANGE ALAIN [FR]


Publication No.: WO2013068969A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING AN ALPHA-ALKOXYSILANE OBTAINED FROM A POLYAMINE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56281 (PCT/IB2012/56281)   Filing Date: 09/Nov/2012

Abstract:

The invention relates to a cosmetic composition, in particular a composition for making up and/or caring for keratin materials, preferably a nail makeup, comprising the compound of chemical formula (I) below:(Formula I) (I) n represents an integer between 1 and 8

R1 and R2 independently represent an ethoxy group or a group (C1-C20)alkyl, optionally substituted with an amino group

X represents a hydrogen atom, a group (C1-C10)alkyl optionally substituted with one or more hydroxyl groups that may optionally be linked to another atom of the group Y to form an alkylene chain, a group (C1-C10)cycloalkyl, an aryl group or a group of formula (II) below:(Formula II) (II) in which R3 and R4 independently represent an ethoxy group or a group (C1-C20)alkyl optionally substituted with an amino group. The invention also relates to a cosmetic process, in particular a makeup or hair shaping process, preferably a process for making up keratin materials, in particular the nails and/or the hair, characterized in that it comprises at least one step which consists in applying a cosmetic composition as above defined to keratin materials.

Priority: FR20110060226 Applic. Date: 2011-11-09; US201161565524P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]; LAGRANGE ALAIN [FR]; SAMAIN HENRI [FR]


Publication No.: WO2013068971A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING A MODIFIED ALPHA-ALKOXYSILANE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56284 (PCT/IB2012/56284)   Filing Date: 09/Nov/2012

Abstract:

The invention relates to a cosmetic composition, in particular a composition for making up and/or caring for keratin materials, preferably a nail makeup, comprising the compound of chemical formula (I) below: (I) in which: a and b independently represent an integer between 0 and 20

R1, R2, R11 and R12 independently represent an ethoxy group, a group (Ci-C2o)alkyl optionally substituted with an amino group

R3, R4, R5, R6, R7, R8, R9 and R1O independently represent a hydrogen atom or a group (C1-C10)alkyl

XI and X2 independently represent a carboxyl, carbamate, amide, carbonate, ureido or sulfonate group, an oxygen atom or a NH group

Y represents a hydrocarbon-based group comprising from 2 to 800 carbon atoms, the said hydrocarbon-based group being a linear or branched divalent group, bearing one or more aromatic or non-aromatic rings. The invention also relates to a cosmetic process, characterized in that it comprises at least one step which consists in applying a cosmetic composition as above defined to keratin materials.

Priority: FR20110060218 Applic. Date: 2011-11-09; US201161565520P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]


Publication No.: WO2013068979A2  Published: 16/May/2013

Title: COSMETIC COMPOSITION COMPRISING AT LEAST ONE ALKOXYSILANE

Applicant/Assignee: L'OREAL

Application No.: WO2012IB56295 (PCT/IB2012/56295)   Filing Date: 09/Nov/2012

Abstract:

The present invention relates to a cosmetic or dermatological composition of sol/gel type for making up and/or caring for keratin materials characterized in that it comprises the product resulting from the reaction: (a) of at least one alkoxysilane monomer or oligomer of formula (I) R1xSi(OR2)(4-x) or of formula (II) [Rly (OR2)z SiO ((4-gamma-zeta)/2)]eta in which R1 represents, independently, a nucleophilic group other than a hydroxyl, or a (Ci-C2o)alkyl group, R2 represents, independently, a (Ci-Cio)alkyl group, and (b) of an amount of water corresponding to a number of moles of water, determined according to the following equation: X - ( llAlkoxysilanes X llbAlkoxy groups ) / nH2o with nH2o = Number of moles of water, nAikoxysiianes = Number of moles of alkoxysilane compounds, nbAikoxy groups = Weighted mean of the number of alkoxysilane groups per alkoxysilane compound, and X is a number greater than 2. It also relates to an associated cosmetic process and an associated kit for coating keratin materials.

Priority: FR20110060212 Applic. Date: 2011-11-09; US201161565519P Applic. Date: 2011-12-01

Inventor: KERGOSIEN GUILLAUME [FR]; RIACHI CARL [FR]; LE CHAUX LAURE [FR]


Publication No.: WO2013069661A1  Published: 16/May/2013

Title: VASCULAR PROGENITOR CELL SHEET DERIVED FROM INDUCED PLURIPOTENT STEM CELLS, AND PRODUCTION METHOD THEREFOR

Applicant/Assignee: NATIONAL UNIVERSITY CORPORATION NAGOYA UNIVERSITY

Application No.: WO2012JP78787 (PCT/JP2012/78787)   Filing Date: 07/Nov/2012

Abstract:

The present invention addresses the problem of providing a vascular progenitor cell sheet derived from induced pluripotent stem cells, which has the strength to tolerate practical applications and exhibits a high treatment effect. This vascular progenitor cell sheet derived from induced pluripotent stem cells is prepared by performing: (1) a step for preparing magnetically labeled Flk-1 positive cells derived from induced pluripotent stem cells

(2) a step for preparing a mixture of the Flk-1 positive cells and a gel material including type I collagen, laminin, type IV collagen and entactin as active ingredients, and then disseminating the mixture in a culture vessel

(3) a step for drawing the Flk-1 positive cells in the mixture to the culture surface of the culture vessel by application of a magnetic force to form a multi-layered cell layer

and (4) a step for gelling the gel material.

Priority: JP20110244046 Applic. Date: 2011-11-08

Inventor: MUROHARA TOYOAKI [JP]; HONDA HIROYUKI [JP]; SHIBATA REI [JP]; ISHII MASAKAZU [JP]; KITO TETSUTARO [JP]; SUZUKI HIROHIKO [JP]


Publication No.: WO2013070018A1  Published: 16/May/2013

Title: COMPOSITION COMPRISING CARNOSIC ACID OR DERIVATIVE THEREOF

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR09458 (PCT/KR2012/09458)   Filing Date: 09/Nov/2012

Abstract:

The present invention relates to a skin irritation alleviation agent comprising carnosic acid, a derivative thereof or a pharmaceutically acceptable salt thereof. The present invention relates to a C-kit activity inhibitor comprising carnosic acid, a derivative thereof or a pharmaceutically acceptable salt thereof. The present invention relates to an elastase activity inhibitor or matrix metalloproteinase (MPP) expression inhibitor comprising carnosic acid, a derivative thereof or a pharmaceutically acceptable salt thereof. The present invention also relates to a whitening composition or anti-ageing composition comprising a carnosic acid derivative or a pharmaceutically acceptable salt thereof.

Priority: KR20110117591 Applic. Date: 2011-11-11; KR20110120662 Applic. Date: 2011-11-18; KR20110146636 Applic. Date: 2011-12-30

Inventor: CHOI SOO JEONG [KR]; BAEK HEUNG SOO [KR]; JOO YUNG HYUP [KR]; JEON SANG HOON [KR]; CHO YOUNG SUK [KR]; SHIN SONG SEOK [KR]; PARK YOUNG HO [KR]


Publication No.: WO2013070236A1  Published: 16/May/2013

Title: METHODS AND COMPOSITIONS FOR TREATING HEMORRHOIDS WHILE PROVIDING LOCAL ANESTHETIC AND ANTI-INFLAMMATORY EFFECTS

Applicant/Assignee: VENTRUS BIOSCIENCES, INC

Application No.: WO2011US60343 (PCT/US2011/60343)   Filing Date: 11/Nov/2011

Abstract:

The present invention relates to compositions and methods for treatment of internal and/or external hemorrhoids, wherein the treatment includes topically administering to a subject a composition comprising from 0.3% to 0.7% of S-2'- [2-(1-methyl-2- piperidyl) ethyl] cinnamanilide, wherein the S-2'- [2-(1-methyl-2-piperidyl) ethyl] cinnamanilide not only treats the hemorrhoidal symptoms but exhibits a local anesthetic effect while controlling inflammation in the area of treatment.

Priority: WO2011US60343 Applic. Date: 2011-11-11

Inventor: AMER MOH SAMIR [US]


Publication No.: WO2013070526A1  Published: 16/May/2013

Title: METHODS FOR THE TREATMENT OF SKIN NEOPLASMS

Applicant/Assignee: TEIKOKU PHARMA USA, INC

Application No.: WO2012US63407 (PCT/US2012/63407)   Filing Date: 02/Nov/2012

Abstract:

Methods of treating skin neoplasms using a monoamine oxidase inhibitor, e.g., a propynylaminoindan (such as rasagiline) are provided. Pharmaceutical compositions and kits comprising monoamine oxidase inhibitors are also provided.

Priority: US201161557632P Applic. Date: 2011-11-09

Inventor: MEIER-DAVIS SUSAN [US]; WEN JIANYE [US]; HAMLIN RICHARD D [US]


Publication No.: WO2013070586A1  Published: 16/May/2013

Title: SMALL MOLECULE MODULATORS OF PRB INACTIVATION

Applicant/Assignee: THE WISTAR INSTITUTE OF ANATOMY AND BIOLOGY

Application No.: WO2012US63683 (PCT/US2012/63683)   Filing Date: 06/Nov/2012

Abstract:

The present invention provides a small molecule treatment of diseases/conditions caused by a virus carrying a viral oncoprotein. In one embodiment, the virus which carries the viral oncoprotein is HPV. The small molecule useful herein includes thiadiazolin-3,5-dione compounds having an optionally substituted aryl group bound to one nitrogen atom of said thiadiazolin-3,5- dione compound. The small molecules may also be administered with a compound which inhibits binding of HPV E6 to p53. In one embodiment, the thiadiazolin-3,5- dione compound has formula (I), or a pharmaceutically acceptable salt, prodrug, solvate, or metabolite thereof, wherein R 1 and R 2 are defined herein.

Priority: US201161558686P Applic. Date: 2011-11-11

Inventor: MARMORSTEIN RONEN [US]; FERA DANIELA [US]


Publication No.: WO2013070861A1  Published: 16/May/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING 7-(1H-IMIDAZOL-4-YLMETHYL)-5,6,7,8-TETRAHYDRO-QUINOLINE FOR TREATING SKIN DISEASES AND CONDITIONS

Applicant/Assignee: ALLERGAN, INC

Application No.: WO2012US64075 (PCT/US2012/64075)   Filing Date: 08/Nov/2012

Abstract:

The present invention relates to a method for treating skin diseases and skin conditions in a patient in need thereof which comprises of administering a therapeutically effective amount of a pharmaceutical composition comprising a therapeutically effective amount of 7-(1H-Imidazol-4-ylmethyl)-5,6,7,8-tetrahydro-quinoline, or its individual enantiomers or the tautomers thereof, or a pharmaceutically acceptable salt thereof.

Priority: US201161558104P Applic. Date: 2011-11-10

Inventor: DIBAS MOHAMMED I [US]; HSIA EDWARD C [US]; DONELLO JOHN E [US]; GIL DANIEL W [US]


Publication No.: WO2013071698A1  Published: 23/May/2013

Title: THREE-RING PI3K AND/OR MTOR INHIBITOR

Applicant/Assignee: XUANZHU PHARMA CO., LTD

Application No.: WO2012CN01551 (PCT/CN2012/01551)   Filing Date: 16/Nov/2012

Abstract:

The present application relates to a compound as represented by general formula (I), pharmaceutically acceptable salt, ester, solvate or stereoisomer thereof, preparation method of the compounds, pharmaceutical composition containing the compounds, uses thereof in the preparation of drugs for treating and/or preventing proliferative diseases, and method using the compounds to treat and/or prevent proliferative diseases. R1, R2, R3, R4, R5, R6, X, A and B in the formula are as defined in the specification.

Priority: CN20111364054 Applic. Date: 2011-11-17; CN2012172834 Applic. Date: 2012-03-20

Inventor: WU FRANK [CN]; ZHANG YAN [CN]


Publication No.: WO2013072050A1  Published: 23/May/2013

Title: NERAMEXANE MESYLATE MONOHYDRATE AND ANHYDRATE

Applicant/Assignee: MERZ PHARMA GMBH & CO. KGAA

Application No.: WO2012EP04734 (PCT/EP2012/04734)   Filing Date: 14/Nov/2012

Abstract:

Method of preparing neramexane mesylate monohydrate, comprising one of steps (i) (iii): (i) exposing neramexane mesylate anhydrate to a humid atmosphere

(ii) suspending neramexane mesylate anhydrate in water

(iii) saturating water with neramexane mesylate.

Priority: EP20110009079 Applic. Date: 2011-11-15; US201161629249P Applic. Date: 2011-11-15

Inventor: QUACK GUENTHER [DE]; PLITT PATRICK [DE]


Publication No.: WO2013073763A1  Published: 23/May/2013

Title: NIACIN-PEPTIDE HAVING SKIN WHITENING ACTIVITY AND USE FOR SAME

Applicant/Assignee: A & PEP INC

Application No.: WO2012KR06674 (PCT/KR2012/06674)   Filing Date: 22/Aug/2012

Abstract:

Provided is niacin-peptide which has skin whitening activity. The peptide of the present invention has skin whitening activity by inhibiting melanogenesis, that is, by inhibiting the expression of a gene related to melanogenesis (for example, TRP-1, TRP2, or MIFT). The peptide of the present invention has high stability and skin permeability. Also provided is a cosmetic composition for skin whitening which contains the niacin-peptide.

Priority: KR20110121135 Applic. Date: 2011-11-18

Inventor: CHOI SUNG-AE [KR]; JEONG HYUK-KWANG [KR]; BYOUN YOUNG-MI [KR]; SHIN JUN-SEOB [KR]; YOO SEO JOON [KR]; YOO SANG-CHUL [KR]


Publication No.: WO2013073926A1  Published: 23/May/2013

Title: TOPICAL PATCH PREPARATION FOR TREATMENT OF TOXICITY OF MOSQUITOES

Applicant/Assignee:

Application No.: WO2012KR09804 (PCT/KR2012/09804)   Filing Date: 19/Nov/2012

Abstract:

A topical patch preparation for treatment of toxicity of mosquitoes proposed by the present invention comprises: a back sheet (100)

and an adhesive heating element (200) stacked and attached to the lower surface of the back sheet (100) and comprising exothermic compositions mixed therein to generate heat. Thus, the topical patch preparation may decompose the toxicity of mosquitoes caused by a mosquito bite simply by using heat without chemicals or drugs so as to immediately relieve itching and swelling.

Priority: KR20110120254 Applic. Date: 2011-11-17

Inventor: LIM HAE EUN [KR]


Publication No.: WO2013073968A2  Published: 23/May/2013

Title: AGENTS FOR MODULATION OF CELL SIGNALLING

Applicant/Assignee: INDUSTRIAL RESEARCH LIMITED, MEAT & LIVESTOCK AUSTRALIA LIMITED

Application No.: WO2012NZ00164 (PCT/NZ2012/00164)   Filing Date: 12/Sep/2012

Abstract:

The present invention relates to methods and peptides for the modulation of gap junction communication between cells. In particular the present invention relates to methods for modulating gap junction communication in mammalian cells, comprising treating the cells with an effective amount of a peptide having the amino acid sequence FHPSS (SEQ ID NO: 3), or a variant form thereof having at least 60% sequence identity with the amino acid sequence and being at least 4 amino acids in length.

Priority: AU20110903730 Applic. Date: 2011-09-12

Inventor: JOHNSON KERYN [NZ]


Publication No.: WO2013074569A1  Published: 23/May/2013

Title: ANTI IL-36R ANTIBODIES

Applicant/Assignee: BOEHRINGER INGELHEIM INTERNATIONAL GMBH

Application No.: WO2012US64933 (PCT/US2012/64933)   Filing Date: 14/Nov/2012

Abstract:

The present invention relates to anti-IL-36R binding compounds, in particular new anti-IL-36R antibodies and therapeutic and diagnostic methods and compositions for using the same.

Priority: US201161560554P Applic. Date: 2011-11-16; US201261644111P Applic. Date: 2012-05-08; US201261713713P Applic. Date: 2012-10-15

Inventor: BROWN SU-ELLEN [US]; CANADA KEITH [US]; CHLEWICKI LUKASZ [US]; HOWELL MICHAEL [US]; MENNERICH DETLEV [DE]; WOSKA JR JOSEPH ROBERT [US]


Publication No.: WO2013075333A1  Published: 30/May/2013

Title: NEW USE OF NEOHESPERIDIN

Applicant/Assignee: NATURAL MEDICINE INSTITUTE OF ZHEJIANG YANGSHENGTANG CO., LTD

Application No.: WO2011CN82950 (PCT/CN2011/82950)   Filing Date: 25/Nov/2011

Abstract:

Disclosed is a use of neohesperidin or plant extract comprising neohesperidin in preparing a product for improving and/or facilitating skin microcirculation or eliminating and/or relieving a disease or state related to bad skin microcirculation. Also disclosed is a combination comprising an effective quantity of neohesperidin or plant extract comprising neohesperidin. Also disclosed is an effect that neohesperidin is beneficial to skin microcirculation and especially to eye skin microcirculation.

Priority: WO2011CN82950 Applic. Date: 2011-11-25

Inventor: HU LIU [CN]; LAN HONGYING [CN]


Publication No.: WO2013075596A1  Published: 30/May/2013

Title: PENTABASIC DIHYDROGEN HETEROCYCLIC KETONE DERIVATIVE AS DHODH INHIBITOR AND USE THEREOF

Applicant/Assignee: EAST CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY

Application No.: WO2012CN84556 (PCT/CN2012/84556)   Filing Date: 14/Nov/2012

Abstract:

The present invention relates to the synthesis and use of a pentabasic dihydrogen heterocyclic ketone derivative of general formula (I) used as a DHODH inhibitor for Plasmodium falciparum, and the compound related to the present invention can be used for the treatment and prevention of diseases related to DHODH, comprising treatment for parasitic diseases, such as malaria, etc., caused by malaria parasites.

Priority: CN20111376668 Applic. Date: 2011-11-23

Inventor: LI HONGLIN [CN]; ZHAO ZHENJIANG [CN]; HUANG JIN [CN]; XU YUFANG [CN]; XU MINGHAO [CN]; DIAO YANYAN [CN]; ZHOU HONGCHANG [CN]; JIN HUANGTAO [CN]; GAO RUI [CN]; ZHU JUNSHENG [CN]


Publication No.: WO2013076170A1  Published: 30/May/2013

Title: 2-[(3,5-DIFLUORO-3'-METHOXY-1,1'-BIPHENYL-4-YL)AMINO]NICOTINIC ACID FOR THE TREATMENT OF PSORIASIS

Applicant/Assignee: ALMIRALL, S.A

Application No.: WO2012EP73278 (PCT/EP2012/73278)   Filing Date: 21/Nov/2012

Abstract:

The present invention provides 2-[(3,5-difluoro-3'-methoxy-1,1'-biphenyl-4- yl)amino]nicotinic acid, or a pharmaceutically acceptable salt or N-oxide or solvate or deuterated derivative thereof,for use in the treatment of psoriasis.

Priority: EP20110382356 Applic. Date: 2011-11-21; US201161565561P Applic. Date: 2011-12-01

Inventor: GODESSART MARINA NURIA [ES]; BALAGUE PELAEZ CRISTINA [ES]


Publication No.: WO2013076275A1  Published: 30/May/2013

Title: ANDROGEN RECEPTOR LIGANDS

Applicant/Assignee: THE PROVOST, FELLOWS, FOUNDATION SCHOLARS, & THE OTHER MEMBERS OF BOARD, OF THE COLLEGE OF THE HOLY&

Application No.: WO2012EP73525 (PCT/EP2012/73525)   Filing Date: 23/Nov/2012

Abstract:

Non ligand binding pocket antagonists for the human androgen receptor. The androgen receptor (AR) is a member of the Nuclear Receptor (NR) family and its role is to modulate the biological effects of the endogenous androgens, testosterone (tes) and dihydrotestosterone (DHT). Synthetic androgens and anti-androgens have therapeutic value in the treatment of various androgen dependent conditions, from regulation of male fertility to prostate cancer. Current treatment of prostate cancer (PCa) typically involves administration of 'classical' antiandrogens, competitive inhibitors of natural AR ligands, DHT and tes, for the ligand binding pocket (LBP) in the C-terminal ligand binding domain (LBD) of the AR. However, prolonged LBP-targeting can often lead to androgen resistance and alternative therapies and therapeutic strategies are urgently required. Disclosed herein are a class of non-steroidal, small molecule AR antagonists which inhibit the transcriptional activity of the AR by non LBP-mediated modulation. The novel class reported demonstrates full ('true') antagonism in AR with low micromolar potency, high selectivity over both the Estrogen Receptors alpha and beta (ERalpha and ERbeta) and the Glucocorticoid Receptor (GR) and only micromolar partial antagonism in the Progesterone Receptor (PR). Data provide compelling evidence for such non-LBP intervention as an alternative approach to classical PCa therapy. (Formula I).

Priority: EP20110190354 Applic. Date: 2011-11-23

Inventor: LLOYD DAVID GEORGE [IE]; FAYNE DARREN [IE]; MEEGAN MARY JANE [IE]; CARR MIRIAM [IE]; KINSELLA GEMMA KARENA [IE]; CABONI LAURA [IE]; JAGOE WILLIAM NICHOLAS [IE]; EGAN BILLY [IE]; BLANCO FERNANDO [ES]


Publication No.: WO2013076516A1  Published: 30/May/2013

Title: 1,4- DIHYDROPYRIDINE DERIVATIVES WITH HSP MODULATING ACTIVITY

Applicant/Assignee: LIPIDART KUTATO FEJLESZTO ES TANACSADO KFT

Application No.: WO2012HU00126 (PCT/HU2012/00126)   Filing Date: 22/Nov/2012

Abstract:

The invention provides 1,4-dihydropyridine derivatives of formula (I) wherein R1 is optionally substituted C6-24aryl group or 5 to 6 membered heteroaryl group comprising 1 to 3 nitrogen atoms or other heteroatoms like oxygen and sulphur, and combinations thereof

R2 and R3 are independently hydrogen or C1-6alkyl group

R4 and R5 are independently hydrogen, C1-6alkyl group optionally substituted with amino, mono-or di(C1-6alkyl)amino, or with 5 to 24 membered optionally fused heterocyclic ring attached by nitrogen and optionally comprising additional 1 to 3 N, O, S heteroatoms and optionally substituted with C1-6alkyl group or C1-6 alkoxy group

R6 is C1-6alkyl, C3-7cycloalkyl, C3-7cycloalkylC1-6alkyl or arylC1-6alkyl group

and stereoisomers including enantiomers, diastereomers, racemic mixtures, mixture of enantiomers and combination thereof, as well as polymorphs, pharmaceutically acceptable salts, solvates, esters and prodrugs thereof for use in the therapeutic or prophylactic treatment of a disorder mediated by heat shock proteins.

Priority: HU20110000646 Applic. Date: 2011-11-24

Inventor: FUELOEP FERENC [HU]; VIGH LASZLO [HU]; TOEROEK ZSOLT [HU]; PENKE BOTOND [HU]; HORVATH IBOLYA [HU]; BALOGH GABOR [HU]; BERNATH SANDOR [HU]; HUNYA AKOS [HU]


Publication No.: WO2013077228A1  Published: 30/May/2013

Title: IMPDH INHIBITOR HAVING MICRORNA AS ACTIVE COMPONENT

Applicant/Assignee: NATIONAL UNIVERSITY CORPORATION OKAYAMA UNIVERSITY

Application No.: WO2012JP79467 (PCT/JP2012/79467)   Filing Date: 14/Nov/2012

Abstract:

Provided is a novel IMPDH inhibitor based on miRNA. This IMPDH inhibitor has, as an active component, oligonucleotides based more specifically on a miR-19a. The oligonucleotides based on miR-19a comprise a base sequence shown in any of 1) to 5) below: 1) the base sequence represented by sequence number 1 (UGUGCAAAUCUAUGCAAAACUGA)

2) the base sequence represented by sequence number 2 (AGUUUUGCAUAGUUGCACUACA)

a base sequence obtained by substitution, deletion, insertion, or addition of one to three nucleotides to a base sequence shown in sequences 1 or 2

base sequences complementary to the base sequences of oligonucleotides shown in any of 1) to 3) above

and base sequences which encode any of the oligonucleotides in 1) to 4) above. The aforementioned oligonucleotides suppress biosynthesis of IMPDH proteins by acting on the mRNA of the IMPDH gene, and can function as an IMPDH inhibitor.

Priority: JP20110257158 Applic. Date: 2011-11-25

Inventor: OUCHIDA MAMORU [JP]


Publication No.: WO2013077569A1  Published: 30/May/2013

Title: TOPICAL SKIN TREATMENT COMPOSITION COMPRISING DENDRANTHEMA INDICUM EXTRACT

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR09258 (PCT/KR2012/09258)   Filing Date: 06/Nov/2012

Abstract:

The present invention relates to a topical skin treatment composition comprising Dendranthema indicum extract and, more particularly, to a topical skin treatment composition containing Dendranthema indicum extract which is excellent for the anti-oxidation, anti-aging, whitening, and moisturizing of skin, and also does not cause skin irritation.

Priority: KR20110122847 Applic. Date: 2011-11-23

Inventor: HWANG KYEONG HWAN [KR]; PARK JUN SEONG [KR]; CHOI HYANG TAE [KR]; YEOM MYEONG HUN [KR]; CHO JUN CHEOL [KR]


Publication No.: WO2013077574A1  Published: 30/May/2013

Title: TOPICAL COMPOSITION CONTAINING THEANINE DERIVATIVES FOR USE ON SKIN

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR09377 (PCT/KR2012/09377)   Filing Date: 08/Nov/2012

Abstract:

The present invention relates to a topical composition for use on skin containing theanine derivatives as active components and, more particularly, to a topical composition for use on skin having anti-aging, skin wrinkle repair, skin barrier enhancement, skin immunity enhancement, skin moisturizing, and atopy alleviation effects by containing theanine derivatives as active components.

Priority: KR20110122748 Applic. Date: 2011-11-23; KR20120125391 Applic. Date: 2012-11-07

Inventor: LEE JIN YOUNG [KR]; YOO JAE WON [KR]; CHOI HYANG TAE [KR]; KIM HAN BYUL [KR]; LEE SUNG HOON [KR]; KIM JI SEONG [KR]; BAE JI HYUN [KR]


Publication No.: WO2013077617A1  Published: 30/May/2013

Title: COMPOSITION FOR PREVENTING, TREATING OR ALLEVIATING ATOPIC DERMATITIS COMPRISING IMMUNOSUPPRESSANT AND TRANSGLUTAMINASE 2 INHIBITOR

Applicant/Assignee: DONGGUK UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION

Application No.: WO2012KR09842 (PCT/KR2012/09842)   Filing Date: 20/Nov/2012

Abstract:

The present invention relates to a composition for preventing, treating or alleviating atopic dermatitis comprising an immunosuppressant and a transglutaminase 2 inhibitor as active ingredients. Conjoint administration of an immunosuppressant and a transglutaminase 2 inhibitor according to the present invention makes it possible to achieve far better therapeutic effects than with administration of either an immunosuppressant or a transglutaminase 2 inhibitor alone, since there is a reduction in the dose of an immunosuppressant which is difficult to administer for a long time because of side effects and with which, when discontinued, lesions are liable to become exacerbated to the original state, and since an immunosuppressant is mixed with a transglutaminase 2 inhibitor which in some patients has a lacklustre effect in treating atopic dermatitis.

Priority: KR20110122447 Applic. Date: 2011-11-22

Inventor: LEE AI-YOUNG [KR]


Publication No.: WO2013077641A1  Published: 30/May/2013

Title: SKIN REPAIR ENHANCER CONTAINING GROWTH FACTORS

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR09919 (PCT/KR2012/09919)   Filing Date: 22/Nov/2012

Abstract:

Disclosed is a skin repair enhancer containing EGF (epidermal growth factor), PDGF-AA (platelet-derived growth factor-AA) and IGF-1 (insulin-like growth factor 1).

Priority: KR20110122388 Applic. Date: 2011-11-22

Inventor: KIM JEONG HWAN [KR]; YI CHANG GEUN [KR]; BAIK SOO JUNG [KR]; KIM HYUK [KR]; JEONG YEON SU [KR]; JEON SANG HOON [KR]; SHIN HONG JU [KR]


Publication No.: WO2013077830A1  Published: 30/May/2013

Title: SYNERGISTILLY ACTIVE COMBINATIONS OF ROFLUMILAST AND CARMOTEROL

Applicant/Assignee:

Application No.: WO2012TR00202 (PCT/TR2012/00202)   Filing Date: 26/Nov/2012

Abstract:

The present invention relates to use of the selective phosphodiesterase-4 (PDE-4) enzyme inhibitor roflumilast and the beta2-adrenergic receptor agonist carmoterol in combined form and pharmaceutical drug compositions comprising said pharmaceutical composition which can be used in allergic and inflammatory diseases of skin and upper and lower respiratory tracts.

Priority: TR20110011669 Applic. Date: 2011-11-25

Inventor: BILGIC MAHMUT [TR]


Publication No.: WO2013078430A1  Published: 30/May/2013

Title: DISUBSTITUTED BETA-LACTONES AS INHIBITORS OF N-ACYLETHANOLAMINE ACID AMIDASE (NAAA)

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, IIT - ISTITUTO ITALIANO DI TECNOLOGIA, UNIVERSITY DEGLI STUDI DI URBINO, UNIVERSITA DEGLI STUDI DI PARMA

Application No.: WO2012US66421 (PCT/US2012/66421)   Filing Date: 21/Nov/2012

Abstract:

The present invention provides compounds and pharmaceutical compositions for inhibiting N-acylethanolamine acid amidase (NAAA). Inhibition of NAAA is contemplated as a method to sustain the levels of palmitoylethanolamide (PEA) and oleylethanolamide (OEA), two substrates of NAAA, in conditions characterized by reduced concentrations of PEA and OEA. The invention also provides methods for treating inflammatory diseases and pain, and other disorders in which decreased levels of PEA and OEA are associated with the disorder.

Priority: US201161562862P Applic. Date: 2011-11-22

Inventor: PIOMELLI DANIELE [US]; BANDIERA TIZIANO [IT]; MOR MARCO [IT]; TARZIA GIORGIO [IT]; BERTOZZI FABIO [IT]; PONZANO STEFANO [IT]


Publication No.: WO2013078446A2  Published: 30/May/2013

Title: DERIVATIVES OF PHENOXYISOBUTYRIC ACID

Applicant/Assignee:

Application No.: WO2012US66443 (PCT/US2012/66443)   Filing Date: 23/Nov/2012

Abstract:

The present invention provides a process for the synthesis of substituted phenoxymethylpropiomc acid and related compounds. The compounds are useful for inhibiting the formation of AGEs (Advanced Glycation End Products).

Priority: US201161563350P Applic. Date: 2011-11-23; US201261742737P Applic. Date: 2012-08-17

Inventor: FABRICANT JILL S [US]; LALEZARI IRAJ [US]


Publication No.: WO2013078523A1  Published: 06/Jun/2013

Title: HETEROCYCLIC N-GLYCINYL-N-ACYL HYDRAZONE COMPOUNDS, SYNTHESIS METHOD, PHARMACEUTICAL COMPOSITIONS AND TREATMENT METHOD

Applicant/Assignee: UNIVERSIDADE FEDERAL DO RIO DE JANEIRO-UFRJ

Application No.: WO2012BR00482 (PCT/BR2012/00482)   Filing Date: 29/Nov/2012

Abstract:

New heterocyclic derivatives are described, having the N-glycinyl-N-acyl hydrazone subunit and acting as analgesic and anti-inflammatory agents with in vitro e in vivo inhibiting activity on pro-inflammatory TNF-alpha cytokine, and useful therefore for the treatment of pain and acute and chronic inflammation, including: relieving hyperalgesia associated with acute and chronic inflammation in mammals, preferably humans. Also described are pharmaceutical compositions containing these compounds and methods for preparing the same.

Priority: BR2011PI06472 Applic. Date: 2011-11-29

Inventor: MANSSOUR FRAGA CARLOS ALBERTO [BR]; DE LACERDA BARREIRO ELIEZER DE JESUS [BR]; BARBOSA LACERDA RENATA [BR]; PALHARES DE MIRANDA ANA LUISA [BR]; LOUBACK DA SILVA LEANDRO [BR]; FREITAS DE LIMA CLEVERTON KLEITON [BR]


Publication No.: WO2013078550A1  Published: 06/Jun/2013

Title: USE OF PULLULAN FOR ALLEVIATING THE APPEARANCE OF SCARS OR SCAR TISSUE

Applicant/Assignee:

Application No.: WO2012CA01110 (PCT/CA2012/01110)   Filing Date: 30/Nov/2012

Abstract:

A system for alleviating the appearance of scar tissue comprising a combination of two compounds

a first compound having properties that perform skin regeneration and a second compound which is puUulan, said puUulan providing a physical barrier which protects scar tissue by insulating it from ambient air and also occluding the first compound.

Priority: GB20110020724 Applic. Date: 2011-12-01

Inventor: GAUTHIER RENE [CA]; MARQUIS CLAUDE [CA]


Publication No.: WO2013078754A1  Published: 06/Jun/2013

Title: PROMOTING HAIR GROWTH SOLUTION CONTAINING CHLORINE DIOXIDE, PREPARATION METHOD AND USE METHOD THEREOF

Applicant/Assignee:

Application No.: WO2012CN00036 (PCT/CN2012/00036)   Filing Date: 09/Jan/2012

Abstract:

An externally used solution containing chlorine dioxide for promoting hair growth is composed of chlorine dioxide or its precursor, pH regulator, medical solvent and plant extract according to certain weight ratio. The product may take the forms of a single solution containing chlorine dioxide or several solutions comprising chlorine dioxide precursor. The safety and efficient oxidation sterilization and tissue regeneration ability of chlorine dioxide are introduced into the solution system for promoting hair growth, and the steps of removing hair loss factors, stimulating the growth of hair follicles, anti-inflammatory and anti-dandruff are done synchronously. Complemented Medical solvent and plant extracts, change alopecia environment.

Priority: CN20111392849 Applic. Date: 2011-12-01

Inventor: LIU XUEWU [CN]


Publication No.: WO2013079211A1  Published: 06/Jun/2013

Title: USE OF PEGYLATED ALCOHOLS FOR THE TREATMENT OF ACTINIC KERATOSIS

Applicant/Assignee: MERZ PHARMA GMBH & CO. KGAA

Application No.: WO2012EP04943 (PCT/EP2012/04943)   Filing Date: 29/Nov/2012

Abstract:

Use of pegylated alcohols for the treatment of actinic keratosis.

Priority: EP20110191387 Applic. Date: 2011-11-30; US201161564893P Applic. Date: 2011-11-30

Inventor: BARG HEIKO [DE]; POOTH RAINER [DE]; ABTS HARRY FRANK [DE]; KIEHM KEVIN [DE]


Publication No.: WO2013079580A1  Published: 06/Jun/2013

Title: METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF DARIER DISEASE

Applicant/Assignee: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE)

Application No.: WO2012EP73936 (PCT/EP2012/73936)   Filing Date: 29/Nov/2012

Abstract:

The present invention relates to methods and pharmaceutical compositions for the treatment of Darier disease. More particularly, the present invention relates to an agent that is able to restore E-cadherin trafficking in DK and the formation of adherens junctions for use in a method for treating patients with Darier disease. In particular, the present invention relates to an agent selected from the group consisting of molecular, chemical and pharmacologic chaperones for use in a method for treating patients with Darier disease.

Priority: EP20110306578 Applic. Date: 2011-11-29

Inventor: HOVNANIAN ALAIN [FR]; SAVIGNAC MAGALI [FR]


Publication No.: WO2013081016A1  Published: 06/Jun/2013

Title: PURINONE DERIVATIVE HYDROCHLORIDE

Applicant/Assignee: ONO PHARMACEUTICAL CO., LTD

Application No.: WO2012JP80769 (PCT/JP2012/80769)   Filing Date: 28/Nov/2012

Abstract:

A hydrochloride of 6-amino-9-[(3R)-1-(2-butynoyl)-3-pyrrolidinyl]-7-(4- phenoxyphenyl)-7,9-dihydro-8H-purin-8-one, which is a purinone derivative, is a compound having a Btk-selective inhibitory activity and excellent metabolism stability, capable of solubilizing and absorbing a free base satisfactorily, and capable of being crystallized. Therefore, the compound can be used as a therapeutic agent for diseases associated with a B cell or a mast cell.

Priority: JP20110259662 Applic. Date: 2011-11-29

Inventor: YAMAMOTO SHINGO [JP]; YOSHIZAWA TOSHIO [JP]


Publication No.: WO2013081118A1  Published: 06/Jun/2013

Title: COMPOUND HAVING READ-THROUGH ACTIVITY

Applicant/Assignee: THE UNIVERSITY OF TOKYO

Application No.: WO2012JP81120 (PCT/JP2012/81120)   Filing Date: 30/Nov/2012

Abstract:

(Problem) To provide a novel compound having read-through activity, and a therapeutic agent for nonsense mutation diseases containing the compound. (Solution) A compound represented by the general formula (1), and a pharmaceutical composition containing the compound.

Priority: JP20110263404 Applic. Date: 2011-12-01

Inventor: HAYASHI YOSHIO [JP]; TAGUCHI AKIHIRO [JP]; YAKUSHIJI FUMIKA [JP]; YAMAZAKI YURI [JP]; MATSUDA RYOICHI [JP]; SHIOZUKA MASATAKA [JP]


Publication No.: WO2013081146A1  Published: 06/Jun/2013

Title: ANTI-WRINKLE COSMETIC

Applicant/Assignee: AJINOMOTO CO., INC

Application No.: WO2012JP81191 (PCT/JP2012/81191)   Filing Date: 30/Nov/2012

Abstract:

Provided is a highly stable and safe cosmetic with excellent anti-wrinkle effect. Further provided is a superior collagen production promoting agent. This anti-wrinkle cosmetic, or collagen production promoting agent, contains a cysteine derivative represented by general formula (I), or a salt thereof [In the formula, X and Y are independently OR1 or NHR2 (In these formulae, R1 and R2 are independently a hydrogen atom or a C1-22 alkyl group.)

Z represents a hydrogen atom or a C1-22 alkyl group

and W represents a C1-22 alkyl group, a C1-22 alkoxy group or a C1-22 alkylamino group.).

Priority: JP20110262163 Applic. Date: 2011-11-30

Inventor: TAKINO YOSHINOBU [JP]; OKURA FUMIE [JP]; KURODA SHINJI [JP]


Publication No.: WO2013081147A1  Published: 06/Jun/2013

Title: WHITENING COSMETIC

Applicant/Assignee: AJINOMOTO CO., INC

Application No.: WO2012JP81192 (PCT/JP2012/81192)   Filing Date: 30/Nov/2012

Abstract:

Provided is a highly safe cosmetic with an excellent whitening effect (which includes prevention and removal of spots). Further provided is a superior melanin production inhibitor. This cosmetic, or melanin production inhibitor, contains (A) a cysteine derivative represented by general formula (I), or a salt thereof [In the formula, X and Y are independently OR1 or NHR2 (In these formulae, R1 and R2 are independently a hydrogen atom or a C1-22 alkyl group.)

Z represents a hydrogen atom or a C1-22 alkyl group

and W represents a C1-22 alkyl group, a C1-22 alkoxy group or a C1-22 alkylamino group.], and (B) a whitener.

Priority: JP20110262164 Applic. Date: 2011-11-30

Inventor: TAKINO YOSHINOBU [JP]; OKURA FUMIE [JP]; KURODA SHINJI [JP]


Publication No.: WO2013081226A1  Published: 06/Jun/2013

Title: NOVEL PHYTOSPINGOSINE DERIVATIVES AND METHOD FOR PREPARING SAME

Applicant/Assignee: LCS BIOTECH CO., LTD

Application No.: WO2011KR09339 (PCT/KR2011/09339)   Filing Date: 02/Dec/2011

Abstract:

A novel omega hydroxylic acid derivative of phytospingosine and a method for preparing same are disclosed. Particularly, provided is an omega hydroxylic acid derivative of phytospingosine obtained by combining a carboxyl group of carbon number omega hydroxylic acid and an amine group of the phytospingosine through amide bonding.

Priority: WO2011KR09339 Applic. Date: 2011-12-02

Inventor: PARK CHANG SEO [KR]; KIM JIN WOOK [KR]; LEE EUN OK [KR]; JANG HYE WON [KR]; PARK SUNG JIN [KR]; LEE SU CHEOL [KR]


Publication No.: WO2013081400A2  Published: 06/Jun/2013

Title: NOVEL BENZAMIDE DERIVATIVE AND USE THEREOF

Applicant/Assignee: VIVOZON, INC

Application No.: WO2012KR10257 (PCT/KR2012/10257)   Filing Date: 29/Nov/2012

Abstract:

The present invention relates to a novel benzamide derivative and a pharmaceutical use thereof, and more specifically, to a novel benzamide derivative of formula 1 or a pharmaceutically acceptable salt thereof, and a composition containing same for the prevention and treatment of pain and itching. The benzamide derivative and the pharmaceutically acceptable salt according to the present invention have a remarkable effect on the suppression of pain. The benzamide derivative and the pharmaceutically acceptable salt have an effect on the suppression of pain not only in a neuropathic animal model but also in a formalin model and other pain-induced models, and thus can be used for the suppression of various kinds of pain such as nociceptive pain and chronic pain. Further, it is confirmed that the present invention has an antipruriginous effect on an itch model in which an established mechanism of pain and concept of treatment is applied, and therefore the antipruriginous composition is useful since the composition can be used for the radical treatment of atopy by suppressing and treating the early itching phase to prevent skin damage and inflammatory response after the scratching phase.

Priority: KR20110125851 Applic. Date: 2011-11-29; KR20120136814 Applic. Date: 2012-11-29

Inventor: LEE DOO HYUN [KR]


Publication No.: WO2013081565A1  Published: 06/Jun/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING ROFLUMILAST AND TERBUTALINE

Applicant/Assignee:

Application No.: WO2012TR00198 (PCT/TR2012/00198)   Filing Date: 19/Nov/2012

Abstract:

The present invention relates to combined use of roflumilast, which is a selective phosphodiesterase-4 (PDE-4) enzyme inhibitor, and terbutaline, which is a beta2adrenergic receptor agonist

and to drug compositions comprising this pharmaceutical combination that can be used in the allergic and inflammatory diseases of skin or upper and lower respiratory tracts.

Priority: TR20110011511 Applic. Date: 2011-11-21

Inventor: BILGIC MAHMUT [TR]


Publication No.: WO2013082196A1  Published: 06/Jun/2013

Title: bFGF-POLYMER CONJUGATES, METHODS FOR MAKING THE SAME AND APPLICATIONS THEREOF

Applicant/Assignee: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA

Application No.: WO2012US66905 (PCT/US2012/66905)   Filing Date: 28/Nov/2012

Abstract:

A heparin mimicking polymer, its conjugate with bFGF, and method of making and using the same are disclosed. In particular, described herein are conjugates of biologic agents (e.g., bFGF) and heparin mimicking polymers having superior stability while retaining full native activity after a variety of stressors.

Priority: US201161564250P Applic. Date: 2011-11-28

Inventor: MAYNARD HEATHER D [US]; NGUYEN THI [US]


Publication No.: WO2013083040A1  Published: 13/Jun/2013

Title: APPLICATION OF FLUOXETINE TO TREATMENT OF DEPIGMENTATION DISEASES

Applicant/Assignee: CHINA PHARMACEUTICAL UNIVERSITY

Application No.: WO2012CN85929 (PCT/CN2012/85929)   Filing Date: 05/Dec/2012

Abstract:

Disclosed is an application of fluoxetine to treatment of depigmentation diseases, and particularly to treatment of vitiligo and white hair.

Priority: CN20111403173 Applic. Date: 2011-12-07

Inventor: SHANG JING [CN]; LIAO SHA [CN]; JIN YU [CN]; TIAN XIAOLI [CN]; ZHAO GUORUI [CN]; ZHOU JIA [CN]; WANG QIAN [CN]; CHONG SILIN [CN]


Publication No.: WO2013083338A1  Published: 13/Jun/2013

Title: NEW PROTEASES ABLE TO HYDROLYZE GLUTEN PEPTIDES AND PROTEINS AT ACIDIC PH, FROM THE ACTINOMYCETE ACTINOALLOMURUS

Applicant/Assignee: FONDAZIONE ISTITUTO INSUBRICO DI RICERCA PER LA VITA

Application No.: WO2012EP71816 (PCT/EP2012/71816)   Filing Date: 05/Nov/2012

Abstract:

The invention relates to a new family of proteolytic enxymes having the ability to hydrolize at a p H between 3 and 8 gluten olygopeptides which are resistant to cleavage by gastric and pancreatic enzymes and whose presence in the intestinal lumen results in toxic effects. The enzymes have been identified as endopeptidases of the S8/S53 family and are produced by an Actinoallomurus strain. The object of the invention includes also methods for producing enzymes composition comprising the endopeptidases by cultivation of native Actinoallomurus strains, mutants thereof, or recombinant host cells comprising nucleic acids codifying for the endopeptidases. Said nucleic acids constitute a further object of the invention. The enzyme compositions comprising at least one endopeptidase of the invention are useful for the treatment and/or prevention of celiac sprue, dermatitis herpetiformis and any other disorder associated with gluten intolerance as ingredients of pharmaceutical formulations or as additives of foods and drinks.

Priority: EP20110425291 Applic. Date: 2011-12-06

Inventor: CAVALETTI LINDA [IT]; CARRANO LUCIA [IT]; ABBONDI MONICA [IT]; BRUNATI MARA [IT]; TARAVELLA ANNA [IT]


Publication No.: WO2013083431A1  Published: 13/Jun/2013

Title: SKIN ANTI-AGEING COMPOSITION

Applicant/Assignee: UNILEVER PLC, UNILEVER N.V, HINDUSTAN UNILEVER LIMITED, CONOPCO, INC., D/B/A UNILEVER

Application No.: WO2012EP73697 (PCT/EP2012/73697)   Filing Date: 27/Nov/2012

Abstract:

The invention relates to a skin anti-ageing composition. In particular a skin anti-ageing composition comprising myricetin or glycoside thereof, and at least one LXR alpha agonist. By skin ageing is meant the appearance or manifestation of any one or more of wrinkles or sagging, poor skin barrier such as dryness, scalp itch, or uneven skin tone such as age spots.

Priority: EP20110192180 Applic. Date: 2011-12-06

Inventor: JENKINS GAIL [GB]; LOTITO SILVINA BEATRIZ [GB]; POPLE JENNIFER ELIZABETH [GB]; WAINWRIGHT LINDA JANE [GB]


Publication No.: WO2013083695A1  Published: 13/Jun/2013

Title: COMPOSITIONS FOR PREVENTING OR TREATING ADVERSE REACTIONS OF EGFR INHIBITION

Applicant/Assignee: APEIRON BIOLOGICS AG

Application No.: WO2012EP74645 (PCT/EP2012/74645)   Filing Date: 06/Dec/2012

Abstract:

The invention discloses a pharmaceutical composition comprising recombinant human superoxide dismutase (rhSOD) for preventing or treating one or more adverse reactions caused by treatment with an EGFR inhibitor in a subject.

Priority: EP20110192223 Applic. Date: 2011-12-06

Inventor: LOIBNER HANS [AT]; SCHNIDAR HARALD [AT]


Publication No.: WO2013084163A1  Published: 13/Jun/2013

Title: COMPOSITION COMPRISING A CHELIDONIUM MAJUS EXTRACT AND COPAIBA, AND THE USE THEREOF FOR THE TREATMENT OF CUTANEOUS DYSFUNCTIONS

Applicant/Assignee: FONDAZIONE SALVATORE MAUGERI CLINICA DEL LAVORO EDELLA RIABILITAZIONE, INTERNATIONAL SOCIETY FOR DRUG DEVELOPMENT S.P.A

Application No.: WO2012IB56988 (PCT/IB2012/56988)   Filing Date: 05/Dec/2012

Abstract:

The present invention relates to compositions comprising an extract of Chelidonium majus and resin of Copaifera officinalis (Copaiba). In particular said Chelidonium majus extracts comprise protopine, stylopine, chelidonine, sanguinarine, chelerythrine, berberine and coptisine. the invention further relates to the use of the composition in the medical and cosmetic fields for the treatment of skin lesions characterised by epidermal hyperproliferation and dermal damage.

Priority: IT2011MI02216 Applic. Date: 2011-12-05

Inventor: PIETRA DANIELE [IT]; BORGHINI ALICE [IT]; DEL CORSO SIMONE [IT]; IMBRIANI MARCELLO [IT]; BIANUCCI ANNA [IT]


Publication No.: WO2013084578A1  Published: 13/Jun/2013

Title: EVALUATION METHOD, SCREENING METHOD, ANTIPRURITIC SUBSTANCE, AND ANTIPRURITIC AGENT

Applicant/Assignee: HOYU CO., LTD

Application No.: WO2012JP75932 (PCT/JP2012/75932)   Filing Date: 05/Oct/2012

Abstract:

Provided is a means for evaluating, screening and obtaining an antipruritic substance effective on an itch that occurs relying on an itching-occurring mechanism that is different from a known itching-occurring mechanism in an animal body. An evaluation method for evaluating the antipruritic effect of a substance of interest by evaluating the effect of inhibiting the activity of an L-histidine decarboxylase (HDC) of which the activity has been activated in a keratinocyte (a keratinized cell) in an epidermis of a mammal.

Priority: JP20110265760 Applic. Date: 2011-12-05

Inventor: INAMI YOSHIHIRO [JP]


Publication No.: WO2013085016A1  Published: 13/Jun/2013

Title: PYRIDONE DERIVATIVE AND MEDICINE CONTAINING SAME

Applicant/Assignee: KAKEN PHARMACEUTICAL CO., LTD

Application No.: WO2012JP81735 (PCT/JP2012/81735)   Filing Date: 07/Dec/2012

Abstract:

General formula (I): The present invention pertains to: a pyridone derivate or a salt thereof represented by general formula (I)

or a medicine containing the pyridone derivative or salt thereof as an active ingredient. [In the formula, ring A, R1, R2, R3 and R4 are specific groups.]

Priority: JP20110270492 Applic. Date: 2011-12-09

Inventor: KAMEI NORIYUKI [JP]; SUMIKAWA YOSHITAKE [JP]; KAMIMURA DAIGO [JP]; TODO SHINGO [JP]; YAMADA TAKUYA [JP]; TOKUOKA SHOTA [JP]


Publication No.: WO2013085017A1  Published: 13/Jun/2013

Title: PYRIDONE DERIVATIVE AND MEDICINE CONTAINING SAME

Applicant/Assignee: KAKEN PHARMACEUTICAL CO., LTD

Application No.: WO2012JP81736 (PCT/JP2012/81736)   Filing Date: 07/Dec/2012

Abstract:

General formula (I): The present invention pertains to: a pyridone derivate or a salt thereof represented by general formula (I)

or a medicine containing the pyridone derivative or salt thereof as an active ingredient. [In the formula, ring A, R1, R2, R3 and R4 are specific groups.]

Priority: JP20110270492 Applic. Date: 2011-12-09

Inventor: KAMEI NORIYUKI [JP]; SUMIKAWA YOSHITAKE [JP]; KAMIMURA DAIGO [JP]; TODO SHINGO [JP]; YAMADA TAKUYA [JP]; TOKUOKA SHOTA [JP]


Publication No.: WO2013085346A1  Published: 13/Jun/2013

Title: NOVEL PHYTOSPHINGOSINE DERIVATIVES, AND COMPOSITION COMPRISING SAME FOR PREVENTING AND TREATING INFLAMMATORY SKIN DISEASES, AUTOIMMUNE DISEASES, AND HYPERKERATOSIS DISEASES

Applicant/Assignee: THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION

Application No.: WO2012KR10642 (PCT/KR2012/10642)   Filing Date: 07/Dec/2012

Abstract:

The present invention relates to novel phytosphingosine derivatives and to a composition comprising same for preventing and treating inflammatory skin diseases, autoimmune diseases and hyperkeratosis diseases. More particularly, the present invention relates to the phytosphingosine derivatives of chemical formula 1 and to a composition comprising the derivatives for preventing and treating inflammatory skin diseases, autoimmune diseases, and hyperkeratosis diseases. The phytosphingosine derivatives of the present invention are involved with transcription factors related to inflammation, autoimmune diseases and hyperkeratosis diseases, the expression and generation of inflammatory mediators, signal transduction mechanisms, and the expression and activity of enzymes and the like, and thus are more effective in preventing, improving, and treating inflammatory skin diseases, autoimmune diseases, and hyperkeratosis diseases than existing phytosphingosines. Thus, the phytosphingosine derivatives of the present invention can be effectively used in preparing competitive medicines.

Priority: KR20110130560 Applic. Date: 2011-12-07

Inventor: KIM BYUNG-HAK [KR]; KIM TAE-YOON [KR]


Publication No.: WO2013085558A1  Published: 13/Jun/2013

Title: METHODS AND COMPOSITIONS FOR ALTERATION OF SKIN PIGMENTATION

Applicant/Assignee:

Application No.: WO2012US29456 (PCT/US2012/29456)   Filing Date: 16/Mar/2012

Abstract:

Compositions are provided that possess levels of phytic acid and optionally a hydroxy acid and/or azelaic acid that act synergistically with the phytic acid to reduce melanin levels in skin. Improved reduction in melanin levels and hyperpigmentation are achieved at low levels of azelaic acid and phytic acid such that greater comfort and reduced irritation are observed at an administration site. Processes of reducing melanin levels or treating hyperpigmentation are provided by topically administering compositions of the invention.

Priority: US201161568469P Applic. Date: 2011-12-08

Inventor: KULESZA JOHN E [US]


Publication No.: WO2013086518A1  Published: 13/Jun/2013

Title: SKIN CARE FORMULATION

Applicant/Assignee: MARY KAY INC

Application No.: WO2012US68796 (PCT/US2012/68796)   Filing Date: 10/Dec/2012

Abstract:

Disclosed is a composition, and method for its use, that includes any one of, any combination of, or all of Centella asiaclico, Vilis vinifera seed, Magnolia bark, Camellia sinensis, and/or dihydroxymethylchromone. The composition can be used to treat telangiectasia.

Priority: US201161570719P Applic. Date: 2011-12-14; US201161569034P Applic. Date: 2011-12-09

Inventor: FLORENCE TIFFANY [US]


Publication No.: WO2013087004A1  Published: 20/Jun/2013

Title: IMIDAZOLIDINEDIONE COMPOUNDS AND THEIR USES

Applicant/Assignee:

Application No.: WO2012CN86573 (PCT/CN2012/86573)   Filing Date: 13/Dec/2012

Abstract:

Provided are imidazolidinedione compounds of formula (I), processes for preparation, uses and pharmaceutically compositions thereof. Said imidazolidinedione compounds possess androgen receptor antagonist activity and can be used for preventing and treating diseases and disorders related to androgen receptor, such as prostate cancer, alopecia, hair regeneration, acne and adolescent acne.

Priority: CN20111418859 Applic. Date: 2011-12-14

Inventor: CHEN YUANWEI [CN]


Publication No.: WO2013087665A2  Published: 20/Jun/2013

Title: COSMETIC COMPOSITION FOR SKIN OR HAIR CARE

Applicant/Assignee: DEQUEST AG

Application No.: WO2012EP75164 (PCT/EP2012/75164)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to the use of a composition comprising, in a cosmetically acceptable medium, a carboxylated fructan compound for the cosmetic treatment of skin, hair or keratin substances. The present invention also relates to a composition comprising carboxylated fructan compound for use as medicine, in particular for the therapeutic or prophylaxis treatment of dermatologic and allergic diseases or disorders.

Priority: EP20110193024 Applic. Date: 2011-12-12

Inventor: BONNECHERE-DELSTANCHE GENEVIEVE [BE]; HENRY OLIVIER [BE]


Publication No.: WO2013087767A1  Published: 20/Jun/2013

Title: COMPOSITIONS FOR ENHANCING SKIN ANTIMICROBIAL DEFENCE

Applicant/Assignee: ISDIN, S.A

Application No.: WO2012EP75381 (PCT/EP2012/75381)   Filing Date: 13/Dec/2012

Abstract:

The present invention provides a combination of urea and isoleucine as active ingredients for sequential, simultaneous or separate administration for use in the prevention and/or treatment of a cutaneous disorder which benefits from an enhancement in the production of endogenous antimicrobial peptides in the skin. The invention further provides topical compositions comprising an effective amount of a combination of urea and isoleucine, wherein both urea and isoleucine act as active ingredients.

Priority: EP20110193691 Applic. Date: 2011-12-15

Inventor: TRULLAS CABANAS CARLES [ES]


Publication No.: WO2013087911A1  Published: 20/Jun/2013

Title: COMPOUNDS AND METHODS FOR TREATING INFLAMMATORY DISEASES

Applicant/Assignee: SYNTHON BIOPHARMACEUTICALS B.V

Application No.: WO2012EP75670 (PCT/EP2012/75670)   Filing Date: 14/Dec/2012

Abstract:

A monoclonal secretory IgA antibody, which binds to and neutralizes a human proinflammatory cytokine or which binds to and blocks a human proinflammatory cytokine receptor. The secretory IgA antibody is useful in treating a variety of inflammatory diseases in humans.

Priority: US201161576727P Applic. Date: 2011-12-16; US201161576922P Applic. Date: 2011-12-16

Inventor: ARIAANS GERARDUS JOSEPH ANDREAS [NL]; DALEN VAN FRANS [NL]; NOLAN DECLAN THOMAS [NL]


Publication No.: WO2013087912A1  Published: 20/Jun/2013

Title: COMPOUNDS AND METHODS FOR TREATING INFLAMMATORY DISEASES

Applicant/Assignee: SYNTHON BIOPHARMACEUTICALS B.V

Application No.: WO2012EP75671 (PCT/EP2012/75671)   Filing Date: 14/Dec/2012

Abstract:

A monoclonal secretory IgA antibody, which binds to and neutralizes human TNFalpha. The secretory antibody is useful in treating a variety of inflammatory conditions in humans.

Priority: US201161576727P Applic. Date: 2011-12-16; US201161576922P Applic. Date: 2011-12-16

Inventor: ARIAANS GERARDUS JOSEPH ANDREAS [NL]; DALEN VAN FRANS [NL]; NOLAN DECLAN THOMAS [NL]


Publication No.: WO2013087913A1  Published: 20/Jun/2013

Title: COMPOUNDS AND METHODS FOR TREATING INFLAMMATORY DISEASES

Applicant/Assignee: SYNTHON BIOPHARMACEUTICALS B.V

Application No.: WO2012EP75672 (PCT/EP2012/75672)   Filing Date: 14/Dec/2012

Abstract:

A monoclonal secretory IgA antibody, which binds to and neutralizes human p40 (the p40 subunit of IL-12 and IL-23). The secretory antibody is useful in treating a variety of inflammatory conditions in humans.

Priority: US201161576727P Applic. Date: 2011-12-16; US201161576922P Applic. Date: 2011-12-16

Inventor: ARIAANS GERARDUS JOSEPH ANDREAS [NL]; DALEN VAN FRANS [NL]; NOLAN DECLAN THOMAS [NL]


Publication No.: WO2013087914A1  Published: 20/Jun/2013

Title: EXPRESSION OF SECRETORY IgA ANTIBODIES IN DUCKWEED

Applicant/Assignee: SYNTHON BIOPHARMACEUTICALS B.V

Application No.: WO2012EP75673 (PCT/EP2012/75673)   Filing Date: 14/Dec/2012

Abstract:

Secretory IgA antibodies can be made by expression in a stably-transformed duckweed.

Priority: US201161576727P Applic. Date: 2011-12-16; US201161576922P Applic. Date: 2011-12-16

Inventor: ARIAANS GERARDUS JOSEPH ANDREAS [NL]; DALEN VAN FRANS [NL]; ROO DE GUY [NL]; NOLAN DECLAN THOMAS [NL]; REGAN JEFF [NL]


Publication No.: WO2013087936A1  Published: 20/Jun/2013

Title: COMBINATION OF A PROSTAGLANDIN RECEPTOR AGONIST AND AN MC1R RECEPTOR AGONIST FOR THE TREATMENT AND/OR PREVENTION OF PIGMENTATION DISORDERS

Applicant/Assignee: GALDERMA RESEARCH & DEVELOPMENT

Application No.: WO2012EP75829 (PCT/EP2012/75829)   Filing Date: 17/Dec/2012

Abstract:

The invention relates to a combination of compounds for the treatment and/or prevention of skin conditions linked to hypopigmentation. It is characterized by a combination product comprising at least one prostaglandin receptor agonist and at least one MC1R receptor agonist, as a medicament for use simultaneously, separately or spread out over time for the treatment and/or prevention of skin conditions linked to hypopigmentation, such as vitiligo.

Priority: FR20110061779 Applic. Date: 2011-12-16

Inventor: MARTEL PHILIPPE [FR]; SUZUKI ITARU [JP]; VOEGEL JOHANNES [FR]; ANDRES PHILIPPE [FR]; RETHORE SANDRINE [FR]


Publication No.: WO2013088063A1  Published: 20/Jun/2013

Title: COSMETIC COMPOSITION CONTAINING THYME HONEY AND NEYRAC MINERAL WATER

Applicant/Assignee: LABORATOIRES M&L

Application No.: WO2012FR52893 (PCT/FR2012/52893)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to a cosmetic composition, to the method for producing same, and to the uses thereof for cosmetic skin treatment. The composition of the present invention contains thyme honey and Neyrac mineral water. Said composition advantageously enables in particular the treatment of sensitive or reactive and/or atopic skin. The present invention also relates in particular to a cosmetic composition that is a composition allowing for the restoration of the cutaneous barrier and/or the fight against cutaneous inflammations and allergies and/or the efficient reparation and healing of the skin, and to a cosmetic treatment method. The composition of the invention also advantageously enables the improvement of the cosmetic appearance of a scar. The present invention is in particular of use in the cosmetic field.

Priority: FR20110061853 Applic. Date: 2011-12-16

Inventor: DEVILARD ELISABETH [FR]; DUGAS ELODIE [FR]; SOUVIGNET BERENGERE [FR]


Publication No.: WO2013088368A2  Published: 20/Jun/2013

Title: USE OF THE MMP-12 PROTEIN IN THE PREVENTION AND/OR TREATMENT OF AGED OR SENESCENT SKIN

Applicant/Assignee: L'OREAL

Application No.: WO2012IB57237 (PCT/IB2012/57237)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to the cosmetic use of an effective amount of at least one active agent consisting of a polypeptide having at least 80% amino acid identity with a metalloproteinase MMP-12 of sequence chosen from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 indicated hereinafter, or a C-terminal fragment of this polypeptide, for preventing and/or treating aged or senescent skin.

Priority: FR20110061623 Applic. Date: 2011-12-14; US201261608947P Applic. Date: 2012-03-09

Inventor: CASTIEL ISABELLE [FR]; GUENICHE AUDREY [FR]


Publication No.: WO2013088369A2  Published: 20/Jun/2013

Title: USE OF THE PROTEIN MMP-12 IN THE PREVENTION AND/OR TREATMENT OF GREASY SKIN AND/OR GREASY-PRONE SKIN

Applicant/Assignee: L'OREAL

Application No.: WO2012IB57238 (PCT/IB2012/57238)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to the cosmetic use of an effective amount of at least one active agent consisting of a polypeptide having at least 80% amino acid identity with a metalloprotease MMP-12 whose sequence is chosen from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 indicated below, or a C-terminal fragment of this polypeptide, for preventing and/or treating greasy skin and/or greasy-prone skin, the said polypeptide or the said fragment comprising the sequence KDXK, in which X represents aspartic acid or glutamic acid.

Priority: FR20110061619 Applic. Date: 2011-12-14; US201261604222P Applic. Date: 2012-02-28

Inventor: CASTIEL ISABELLE [FR]; GUENICHE AUDREY [FR]


Publication No.: WO2013088370A2  Published: 20/Jun/2013

Title: USE OF THE PROTEIN MMP-12 IN THE PREVENTION AND/OR TREATMENT OF SENSITIVE SKIN

Applicant/Assignee: L'OREAL

Application No.: WO2012IB57239 (PCT/IB2012/57239)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to the cosmetic use of an effective amount of at least one active agent consisting of a polypeptide having at least 80% amino acid identity with a metalloprotease MMP-12 whose sequence is chosen from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 indicated below, or a C-terminal fragment of this polypeptide, for preventing and/or treating sensitive skin, the said polypeptide or the said fragment comprising the sequence KDXK, in which X represents aspartic acid or glutamic acid. The present invention is directed mainly toward proposing a novel active agent for preventing and/or treating sensitive skin.

Priority: FR20110061620 Applic. Date: 2011-12-14; US201261608953P Applic. Date: 2012-03-09

Inventor: CASTIEL ISABELLE [FR]; GUENICHE AUDREY [FR]


Publication No.: WO2013088371A2  Published: 20/Jun/2013

Title: USE OF THE MMP-12 PROTEIN IN THE PREVENTION AND/OR TREATMENT OF DANDRUFF CONDITIONS OF THE SCALP

Applicant/Assignee: L'OREAL

Application No.: WO2012IB57242 (PCT/IB2012/57242)   Filing Date: 12/Dec/2012

Abstract:

The present invention relates to the cosmetic use of an effective amount of at least one active agent consisting of a polypeptide having at least 80% amino acid identity with a metalloproteinase MMP-12 of sequence chosen from SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or a C-terminal fragment of said polypeptide, for preventing and/or treating dandruff conditions of the scalp, said polypeptide or said fragment comprising the sequence KDXK, in which X represents aspartic acid or glutamic acid.

Priority: FR20110061621 Applic. Date: 2011-12-14; US201261603384P Applic. Date: 2012-02-27

Inventor: GUENICHE AUDREY [FR]; CASTIEL ISABELLE [FR]


Publication No.: WO2013089533A1  Published: 20/Jun/2013

Title: COMPOSITION CONTAINING TANGERETIN FOR EXTERNAL APPLICATION TO THE SKIN

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR11009 (PCT/KR2012/11009)   Filing Date: 17/Dec/2012

Abstract:

The present invention provides a composition containing tangeretin as an active ingredient for external application to the skin. The present invention also provides a composition containing tangeretin and EGCG for external application to the skin. The present invention also provides a composition for external application to the skin, comprising, as an active ingredient, mandarin peel extracts containing tangeretin. The present invention also provides a composition for external application to the skin comprising mandarin peel extracts containing tangeretin and further comprising green tea extracts containing Epigallocatechin gallate (EGCG). The composition of the present invention has excellent antioxidative effects and therefore can be applied as a cosmetic composition, a pharmaceutical composition or a health food composition. Further, the composition of the present invention may have superior effects of preventing skin erythema, improving skin tone and preventing skin aging.

Priority: KR20110136181 Applic. Date: 2011-12-16; KR20120146540 Applic. Date: 2012-12-14

Inventor: PARK AN NA [KR]; HONG YEON JU [KR]; KIM YOUN JOON [KR]; HAN SANG HOON [KR]


Publication No.: WO2013089832A1  Published: 20/Jun/2013

Title: MODULATION OF THYMOSIN BETA-4 IN SKIN

Applicant/Assignee: AVON PRODUCTS, INC

Application No.: WO2012US49833 (PCT/US2012/49833)   Filing Date: 07/Aug/2012

Abstract:

Methods for preventing, ameliorating, or reducing dermatological signs of aging are provided which employ active agents, other than a retinoid, that stimulate thymosin beta-4 expression in the skin. Also provided are methods for screening for substances which stimulate thymosin beta-4 expression levels and the methods of using active agents identified by the screening protocol in the treatment of skin.

Priority: US201113324150 Applic. Date: 2011-12-13

Inventor: CHEN SIMING W [US]; ZHENG QIAN [US]; PARIMOO SATISH [US]


Publication No.: WO2013090986A1  Published: 27/Jun/2013

Title: TREATMENT OF SEBORRHOEA

Applicant/Assignee: MCFARLANE MARKETING (AUST.) PTY. LTD

Application No.: WO2012AU01543 (PCT/AU2012/01543)   Filing Date: 14/Dec/2012

Abstract:

A method for the treatment of seborrhoea in a patient comprises administering to the patient an effective amount of (24RS) or (24S) scymnol, an ester thereof or a pharmaceutically acceptable salt of a said ester, or of (24R) scymnol.

Priority: AU20110905331 Applic. Date: 2011-12-20; AU20120900670 Applic. Date: 2012-02-22

Inventor: MACRIDES THEODORE [AU]; BROADBENT ANDREW [AU]


Publication No.: WO2013090991A1  Published: 27/Jun/2013

Title: TGF-BETA THERAPY

Applicant/Assignee: THE UNIVERSITY OF SYDNEY

Application No.: WO2012AU01550 (PCT/AU2012/01550)   Filing Date: 18/Dec/2012

Abstract:

A method of minimising inflammation in one or more tissues of an individual including selecting and/or providing an individual having one or more inflamed tissues, and in which the one or more inflamed tissues have been treated to deplete substantially all beta-catenin/Smad3 complexes in the tissues

applying TGF-beta1 to said one or more tissues in an amount effective for inducing an anti-inflammatory response in said one or more tissues, thereby minimising inflammation in said one or more tissues of said individual.

Priority: AU20110905390 Applic. Date: 2011-12-22

Inventor: HARRIS DAVID [AU]; GUOPING ZHENG [AU]


Publication No.: WO2013091053A1  Published: 27/Jun/2013

Title: POLYMER COMPOSITION CONTAINING NATURAL BIOACTIVE PRINCIPLES FOR USE IN PHARMACEUTICAL AND COSMETIC FORMULATIONS

Applicant/Assignee: BIOACTIVE TECNOLOGIA EM POLIMEROS LTDA-ME

Application No.: WO2012BR00520 (PCT/BR2012/00520)   Filing Date: 20/Dec/2012

Abstract:

The present invention relates to a polymer composition containing natural bioactive principles, in particular propolis extract. The present composition is of value because it exhibits antimicrobial (antibacterial, antifungal, antiviral and antiprotozoal), wound healing, anti-inflammatory, antioxidising and moisturising properties. The composition according to the present invention can be used in pharmaceutical and cosmetic formulations, thus being useful for odontological treatments (of caries, gingivitis, periodontitis, bad breath, aphthae, oral stomatitis) and for the treatment of affections of the skin and mucous membranes. The present composition also contains biocompatible and biodegradable polymers that allow controlled release of the active principles. For this purpose, the product can be provided in the form of different formulations: spray, mouthwash, toothpaste, oral-base cream, lotions, creams, gels, inter alia.

Priority: BR2011PI06762 Applic. Date: 2011-12-22

Inventor: CABRERA WALTER ISRAEL ROJAS [BR]; NAKAJIMA KARINA [BR]; BENDO LUANA [BR]


Publication No.: WO2013091539A1  Published: 27/Jun/2013

Title: PYRROLE SIX-MEMBERED HETEROARYL RING DERIVATIVE, PREPARATION METHOD THEREFOR, AND MEDICINAL USES THEREOF

Applicant/Assignee: JIANGSU HENGRUI MEDICINE CO., LTD, SHANGHAI HENGRUI PHARMACEUTICAL CO., LTD

Application No.: WO2012CN86922 (PCT/CN2012/86922)   Filing Date: 19/Dec/2012

Abstract:

The present invention relates to a pyrrole six-membered heteroaryl ring derivative, the preparation method therefor, and the medicinal uses thereof. Specifically, the present invention relates to a new pyrrole six-membered heteroaryl ring derivative as represented in formula (I), the preparation method therefor, a medicinal composition comprising the derivative, and a therapeutic agent using same, and, in particular, the uses as a JAK inhibitor and an immunosuppressor. Substituents in formula (I) have the same definitions as in description.

Priority: CN20111434071 Applic. Date: 2011-12-21

Inventor: ZHANG XUEJUN [CN]; DONG QING [CN]; LIU BONIAN [CN]; ZHU YAOPING [CN]; LI XIAOTAO [CN]; LAN JIONG [CN]


Publication No.: WO2013092269A1  Published: 27/Jun/2013

Title: PHARMACEUTICAL COMPOSITIONS COMPRISING GLITAZONES AND NRF2 ACTIVATORS

Applicant/Assignee: ARES TRADING S.A

Application No.: WO2012EP74915 (PCT/EP2012/74915)   Filing Date: 10/Dec/2012

Abstract:

The invention relates to pharmaceutical compositions comprising PPAR agonists and Nrf2 activators and methods of using combinations of PPAR agonists and Nrf2 activators for treating diseases such as psoriasis, asthma, multiple sclerosis, inflammatory bowel disease, and arthritis.

Priority: EP20110194292 Applic. Date: 2011-12-19; EP20120004652 Applic. Date: 2012-06-21; US201261663761P Applic. Date: 2012-06-25; US201213654632 Applic. Date: 2012-10-18

Inventor: KAHRS BJOERN COLIN [CH]


Publication No.: WO2013093019A1  Published: 27/Jun/2013

Title: ACRIDINEDIONE DERIVATIVES FOR TREATING PIGMENTATION DISORDERS AND AGEING OF THE SKIN

Applicant/Assignee: PIERRE FABRE DERMO-COSMETIQUE

Application No.: WO2012EP76681 (PCT/EP2012/76681)   Filing Date: 21/Dec/2012

Abstract:

The present invention relates to a compound of general formula (I) in which: - R1 and R2 are simultaneously or independently H, OH, OCH3 or a C1-C5 alkyl radical, - R3 and R4 are simultaneously CH3, - or R3 is H and R4 is CH3, CH2CH3 or an isopropyl radical or a phenyl radical, - R5 is a C4-C24 alkyl radical or a 3-phenylpropanyl or 2,2-diphenylethanyl radical.

Priority: FR20110062204 Applic. Date: 2011-12-21

Inventor: POIGNY STEPHANE [FR]; BELAUBRE FRANCOISE [FR]


Publication No.: WO2013093880A1  Published: 27/Jun/2013

Title: USE OF STEVIOL, OF A STEVIOL GLYCOSIDE DERIVATIVE OR OF ONE OF THEIR ISOMERS TO PREVENT, REDUCE AND/OR TREAT A DETRIMENTAL CHANGE IN THE COMPLEXION OF THE SKIN

Applicant/Assignee: L'OREAL

Application No.: WO2012IB57613 (PCT/IB2012/57613)   Filing Date: 21/Dec/2012

Abstract:

The present invention relates to the use by the topical route of steviol, of a steviol glycoside derivative or of one of their isomers to prevent, reduce and/or treat a detrimental change in the complexion of the skin.

Priority: FR20110062393 Applic. Date: 2011-12-23; US201261585080P Applic. Date: 2012-01-10

Inventor: LABOUREAU JULIEN [FR]; KAUFFMANN MYRIAN [FR]; BALDO FRANCINE [FR]; MAHE YANN [FR]


Publication No.: WO2013094489A1  Published: 27/Jun/2013

Title: METHOD FOR PREPARING HAIR GROWTH AGENT, AND COMPOSITION PREPARED BY SAID METHOD

Applicant/Assignee: SANSHO SEIYAKU CO.,LTD

Application No.: WO2012JP82184 (PCT/JP2012/82184)   Filing Date: 12/Dec/2012

Abstract:

Provided are: a method for adjusting the optimal blend amount of 6-benzylaminopurine at which the hair growth effect of 6-benzylaminopurine can be exhibited

and a hair growth agent composition produced by the method. The present invention provides: a method for preparing a solution using a mixed solvent of water and ethanol in which the solvent ratio of water to ethanol is 65:35 to 10:90 (by weight) relative to an effective concentration of 0.2 to 1.0 wt% of 6-benzylaminopurine

and a hair growth agent composition prepared using a solution produced by the method. The hair growth agent composition can be used particularly as a hair tonic.

Priority: JP20110276738 Applic. Date: 2011-12-19

Inventor: HONDA SHINSUKE [JP]


Publication No.: WO2013094683A1  Published: 27/Jun/2013

Title: COMPOSITION FOR SKIN CONTAINING SILICONE BASE

Applicant/Assignee: MARUHO CO., LTD

Application No.: WO2012JP83063 (PCT/JP2012/83063)   Filing Date: 20/Dec/2012

Abstract:

The present invention addresses the problem of providing a composition for the skin, which has excellent texture and feeling of use. The present invention provides an anhydrous composition for the skin, which is characterized in that: (A) 80% by weight or more of the composition is composed of a silicone base

(B) the silicone base contains (b1) a silicone elastomer, (b2) a cyclic volatile methyl siloxane that has 3-6 silicon atoms and (b3) a linear dimethyl polysiloxane and/or a linear methylphenyl polysiloxane

(C) the composition contains an active component that is present in a dispersed or dissolved state

and (D) the composition does not contain a non-silicone thickener.

Priority: JP20110279249 Applic. Date: 2011-12-21

Inventor: HORISAWA EIJIRO [JP]; IHARA MIKITO [JP]


Publication No.: WO2013094882A1  Published: 27/Jun/2013

Title: TOPICAL SKIN PREPARATION COMPOSITION INCLUDING SIRAITIA GROSVENORI EXTRACT FOR IMPROVING SKIN COMPLEXION

Applicant/Assignee: AMOREPACIFIC CORPORATION

Application No.: WO2012KR09580 (PCT/KR2012/09580)   Filing Date: 14/Nov/2012

Abstract:

The present invention relates to a topical skin preparation composition including a Siraitia grosvenori extract, and more particularly, to a topical skin preparation composition for improving skin complexion and providing skin transparency effects by including the Siraitia grosvenori extract.

Priority: KR20110137198 Applic. Date: 2011-12-19

Inventor: LEE OK CHAN [KR]; KIM DONG HYUN [KR]; RYU KWON REAL [KR]; YEOM MYEONG HUN [KR]; CHO JUN CHEOL [KR]


Publication No.: WO2013096182A2  Published: 27/Jun/2013

Title: COMPOSITIONS COMPRISING GALLATES AND GALLAMIDES

Applicant/Assignee: COLGATE-PALMOLIVE COMPANY

Application No.: WO2012US70062 (PCT/US2012/70062)   Filing Date: 17/Dec/2012

Abstract:

Described herein are compositions for topical use comprising an antibacterially effective concentration of a gallate or gallamide compound which is a polysubstituted cycloalkyl or heterocycloalkyl wherein the substituents are selected from hydroxy, hydroxymethyl, fluoro, chloro, amino, nitro, or a moiety of formula -X-(CO)-(3,4,5-trihydroxyphenyl), wherein X is selected from O and NH, provided that the substituents comprise at least two moieties of formula -X-(CO)-(3,4,5-trihydroxyphenyl) attached to adjacent carbons in free or in orally or topically acceptable salt form, as well as methods of making and using the same.

Priority: US201113333209 Applic. Date: 2011-12-21

Inventor: JARACZ STANISLAV [US]; XU GUOFENG [US]; MILLER STEVEN [US]; LEIGH LEONORA [US]; PICQUET GUILLAUME [US]; DU-THUMM LAURENCE [US]


Publication No.: WO2013096516A1  Published: 27/Jun/2013

Title: METHODS FOR TREATING ACNE

Applicant/Assignee: XOMA TECHNOLOGY LTD

Application No.: WO2012US70734 (PCT/US2012/70734)   Filing Date: 19/Dec/2012

Abstract:

The present disclosure relates to methods and materials for treating acne in a subject including, for example, moderate and/or severe acne, using anti-IL-1betabinding molecules such as an anti-IL-1betaantibody or binding fragment thereof.

Priority: US201161577450P Applic. Date: 2011-12-19

Inventor: RUBIN PAUL [US]


Publication No.: WO2013096723A1  Published: 27/Jun/2013

Title: A METHOD FOR HAIR GROWTH USING GRANULOCYTE-COLONY STIMULATING FACTOR

Applicant/Assignee: SAREF TECHNOLOGIES, INC

Application No.: WO2012US71144 (PCT/US2012/71144)   Filing Date: 21/Dec/2012

Abstract:

The present invention provides a method for re-growing hair in patients with androgenic alopecia by administering effective consecutive courses of Granulocyte-Colony Stimulating Factor or derivatives. After the state of re-growth is obtained, the hair growth is maintained by administering periodic courses of Granulocyte-Colony Stimulating Factor or derivatives. The invention further provides a method for increasing cuticle growth and density using a similar administration of effective consecutive courses of Granulocyte-Colony Stimulating Factor or derivatives. The increased cuticle growth and density is maintained by administering periodic courses of Granulocyte-Colony Stimulating Factor or derivatives.

Priority: US201161579975P Applic. Date: 2011-12-23; US201213721111 Applic. Date: 2012-12-20

Inventor: LOPEZ CARLOS [US]; PETELL JAMES K [US]


Publication No.: WO2013096725A1  Published: 27/Jun/2013

Title: ASTRAGALUS SEED EXTRACT SOLUTION AND ITS USE FOR TREATING SKIN DISORDERS AND CONDITIONS

Applicant/Assignee: NEFELI CORP

Application No.: WO2012US71153 (PCT/US2012/71153)   Filing Date: 21/Dec/2012

Abstract:

An aqueous Astragalus seed extract solution prepared by a method including soaking dried seeds of Astragalus seed in an aqueous solvent to form a suspension, boiling the suspension for at least 30 minutes, and filtering the suspension so as to obtain the Astragalus seed aqueous extract solution, the weight ratio of the dried seeds of Astragalus seed to the extract solution being 1:100 to 75:100.

Priority: US201161579726P Applic. Date: 2011-12-23

Inventor: ZHANG PING [US]


Publication No.: WO2013097052A1  Published: 04/Jul/2013

Title: BROMODOMAIN INHIBITORS

Applicant/Assignee: ABBOTT LABORATORIES, ABBOTT LABORATORIES TRADING (SHANGHAI) COMPANY, LTD

Application No.: WO2011CN02224 (PCT/CN2011/02224)   Filing Date: 30/Dec/2011

Abstract:

Provided are compounds of formula (I), wherein A1, A2, A3, A4, X1, X2, Y1, L1, G1, Rx, and Ry have any of the values defined therefor in the specification, and pharmaceutically acceptable salts thereof, that are useful as agents in the treatment of diseases and conditions, including inflammatory diseases, cancer, and AIDS. Also provided are pharmaceutical compositions comprising one or more compounds of formula (I).

Priority: WO2011CN02224 Applic. Date: 2011-12-30

Inventor: WANG LE [US]; PRATT JOHN K [US]; MCDANIEL KEITH F [US]


Publication No.: WO2013097920A1  Published: 04/Jul/2013

Title: METAL COMPLEXES COMPRISING 1,2,3-TRIAZOLES

Applicant/Assignee: MERCK PATENT GMBH, UNIVERSITAET REGENSBURG

Application No.: WO2012EP04979 (PCT/EP2012/04979)   Filing Date: 03/Dec/2012

Abstract:

The present invention relates inter alia to a new class of metal complexes comprising 1,2,3-triazoles having improved solubility and enhanced electro-optical properties. The present invention further relates to the preparation and use of these compounds.

Priority: EP20110010217 Applic. Date: 2011-12-27

Inventor: ANEMIAN REMI MANOUK [KR]; EBERLE THOMAS [DE]; STOESSEL PHILIPP [DE]; KOENIG BURKHARD [DE]


Publication No.: WO2013098333A1  Published: 04/Jul/2013

Title: COMBINATION OF GROWTH FACTORS, CYTOKINES, ANTIBACTERIAL/ANTIVIRAL FACTORS, STEM CELL STIMULATING FACTORS, COMPLEMENT PROTEINS C3A/C4A, IMMUNOGLOBULINS AND CHEMOTACTIC FACTORS

Applicant/Assignee: BIONEST LTD

Application No.: WO2012EP76962 (PCT/EP2012/76962)   Filing Date: 27/Dec/2012

Abstract:

The present invention refers to a combination of growth factors, cytokines, antibacterial/antiviral factors, stem cell stimulating factors, complement proteins C3a/C4a, immunoglobulins and chemotactic factors. The invention also relates to a process for the preparation of said combination from serum, placenta or colostrum and to composition containing said combination for use in the treatment of conditions requiring tissue repair and regeneration and for the substitution of stem cell therapies.

Priority: IT2011MI02432 Applic. Date: 2011-12-30; IT2011MI02433 Applic. Date: 2011-12-30; IT2011MI02435 Applic. Date: 2011-12-30; IT2011MI02439 Applic. Date: 2011-12-30; IT2011MI02440 Applic. Date: 2011-12-30; IT2011MI02441 Applic. Date: 2011-12-30; IT2011MI02443 Applic. Date: 2011-12-30; IT2011MI02445 Applic. Date: 2011-12-30; IT2011MI02446 Applic. Date: 2011-12-30

Inventor: BARTORELLI ALBERTO [CH]; GOBBI MARIA ROSA [IT]


Publication No.: WO2013098449A1  Published: 04/Jul/2013

Title: COMPOSITION OF NATURAL PRODUCTS FOR TOPICAL APPLICATION

Applicant/Assignee:

Application No.: WO2012ES70897 (PCT/ES2012/70897)   Filing Date: 21/Dec/2012

Abstract:

The invention relates to a composition of natural products for topical application characterised by including Portulaca oleracea (purslane) in a ratio of 91.75 % to 95.43 %, combined with other substances of natural origin, such as Hypericum perforatum (St. John's wort), Triticum aestivum (wheat), Malva spp. (mallow), Urtica urens (nettle) and Arnica montana (mountain arnica), which increase the restorative capacity of the tissue, in a ratio of 0.1 % to 2 % each. Said composition for topical application can be provided as a gel, emulsion, cream or spray and can be used on burns, eroded skin, position-related ulcers, psoriasis lesions, skin lesions caused by herpes zoster, ulcers caused by diabetic foot, on eye irritations when provided as eye drops, as an effective coagulant, for preparing a cosmetic or dermatological composition and in the field of veterinary medicine.

Priority: ES20120000006 Applic. Date: 2011-12-28

Inventor: TUDINI ROBERTO [ES]


Publication No.: WO2013098743A1  Published: 04/Jul/2013

Title: COMPOSITION FOR A MEDICAL DEVICE OR FOR A COSMETIC OR PHARMACEUTICAL PREPARATION COMPRISING A DECAPEPTIDE DERIVED FROM DEINOCOCCUS RADIODURANS

Applicant/Assignee: BIODUE S.P.A

Application No.: WO2012IB57621 (PCT/IB2012/57621)   Filing Date: 21/Dec/2012

Abstract:

The present invention relates to a composition comprising a decapeptide of bacterial origin, which can also produced via chemical synthesis, and the use of said composition in the therapeutic or cosmetic field or in a medical device.

Priority: IT2011MI02390 Applic. Date: 2011-12-27

Inventor: EMANUELE ENZO [IT]; BENEDETTI RUFFO [IT]


Publication No.: WO2013099378A1  Published: 04/Jul/2013

Title: COLLAGEN PRODUCTION PROMOTER

Applicant/Assignee: SHISEIDO COMPANY, LTD

Application No.: WO2012JP74763 (PCT/JP2012/74763)   Filing Date: 26/Sep/2012

Abstract:

Provided is a novel plant-derived collagen production promoter having an excellent collagen production promoting action. The invention comprises an extract from the plant Peucedanum japonicum Thunb. belonging to the Peucedanum L. genus of the Umbelliferae family, or from an organic solvent or water-containing organic solvent thereof.

Priority: JP20110285155 Applic. Date: 2011-12-27

Inventor: YOKOI TOKIYA [JP]; ITO AKIRA [JP]


Publication No.: WO2013100003A1  Published: 04/Jul/2013

Title: METHOD FOR PURIFYING OLIGOMERIC PROANTHOCYANIDIN, METHOD FOR CONTROLLING DEGREE OF POLYMERIZATION, HYALURONIDASE INHIBITOR, AND COLLAGENASE INHIBITOR

Applicant/Assignee: SUNTORY HOLDINGS LIMITED

Application No.: WO2012JP83770 (PCT/JP2012/83770)   Filing Date: 27/Dec/2012

Abstract:

A method for purifying an oligomeric proanthocyanidin, comprising an extraction step of extracting a raw material containing multiple types of oligomeric proanthocyanidins having different degrees of polymerization with an extraction solvent selected from water and an aqueous alcohol solution, wherein the alcohol concentration in the extraction solvent is preset in accordance with the degree of polymerization of a desired oligomeric proanthocyanidin in the extraction step and the oligomeric proanthocyanidin having a desired degree of polymerization is extracted using the extraction solvent.

Priority: JP20110288803 Applic. Date: 2011-12-28

Inventor: KASAJIMA NAOKI [JP]; YOSHIMOTO YUKO [JP]; FUKUI YUKO [JP]


Publication No.: WO2013100027A1  Published: 04/Jul/2013

Title: HETEROCYCLIC COMPOUND

Applicant/Assignee: TAKEDA PHARMACEUTICAL COMPANY LIMITED

Application No.: WO2012JP83826 (PCT/JP2012/83826)   Filing Date: 27/Dec/2012

Abstract:

Provided is a heterocyclic compound having RORgammat-inhibiting activity. A compound represented by formula (1) (in the formula, each substituent is as stated in the specification) or a salt thereof.

Priority: JP20110290147 Applic. Date: 2011-12-28

Inventor: YAMAMOTO SATOSHI [JP]; SHIRAI JUNYA [JP]; TOMATA YOSHIHIDE [JP]; KOUNO MITSUNORI [JP]; OCHIDA ATSUKO [JP]; SATO AYUMU [JP]; FUKASE YOSHIYUKI [JP]; YONEMORI KAZUKO [JP]; KOYAMA RYOKICHI [JP]


Publication No.: WO2013100105A1  Published: 04/Jul/2013

Title: MAILLARD REACTION INHIBITOR

Applicant/Assignee: MORISHITA JINTAN CO., LTD

Application No.: WO2012JP83992 (PCT/JP2012/83992)   Filing Date: 27/Dec/2012

Abstract:

Provided are: a Maillard reaction inhibitor which can inhibit the progress of a Maillard reaction in a living body effectively, does not cause any adverse side effect, can be applied safely, and can be produced without requiring any complicated process

and an anti-aging agent for skin, an anti-diabetic complication agent, a food and a beverage, in each of which the Maillard reaction inhibitor is used. The Maillard reaction inhibitor according to the present invention contains 50 to 90 mass% of a polyphenol as an active ingredient. The Maillard reaction inhibitor according to the present invention has a potent inhibitory activity on a Maillard reaction, and therefore can inhibit a Maillard reaction in a living body efficiently and can prevent and improve various functional disorders of proteins occurring in a living body. Due to this activity, the Maillard reaction inhibitor can prevent aging and is useful for the prevention and treatment of diabetic complications. When the tannin is added to a collagen-containing food or beverage, the occurrence of a Maillard reaction in the food or beverage can be prevented to thereby prevent the deterioration of the food or beverage, and the occurrence of a Maillard reaction in a living body can also be prevented.

Priority: JP20110285694 Applic. Date: 2011-12-27

Inventor: NISHIDA NORIHISA [JP]; NAGATOMO AKIFUMI [JP]; ITO HIDEYUKI [JP]


Publication No.: WO2013100459A1  Published: 04/Jul/2013

Title: COMPOSITION COMPRISING HAIR TELOGEN- OR CATAGEN-INDUCING AGENT FOR PREVENTING AND ALLEVIATING ALOPECIA CAUSED BY ANTICANCER THERAPY

Applicant/Assignee: SNU R&DB FOUNDATION

Application No.: WO2012KR10983 (PCT/KR2012/10983)   Filing Date: 17/Dec/2012

Abstract:

Disclosed is a pharmaceutical composition comprising one or more hair telogen- and/or catagen-inducing agents for preventing and alleviating alopecia caused by anticancer chemotherapy and radiotherapy. Also disclosed is a method for preventing and alleviating alopecia caused by anticancer chemotherapy and radiotherapy, said method comprising a step of topically administrating one or more hair anagen- and/or catagen-inducing agents into the scalp of a patient in an effective dosage for prevention, alleviation or treatment. Further disclosed is a method for preventing and alleviating alopecia due to anticancer chemotherapy and radiotherapy by inducing a hair growth cycle through anagen and/or catagen. The composition and method according to the present invention can reduce dystrophy of hair caused by anticancer chemotherapy and radiotherapy to thereby reduce alopecia which is a side effect, and also facilitate the primary recovery of hair after alopecia. Therefore, the composition of the present invention can maximize therapeutic effects by preventing and/or repressing alopecia caused by side effects, when used together with cancer therapy to improve the quality of life of patients and encourage patients to actively participate in cancer therapy.

Priority: KR20110145642 Applic. Date: 2011-12-29

Inventor: KWON OH SANG [KR]; KIM KYU HAN [KR]; EUN HEE CHUL [KR]; CHUNG JIN HO [KR]; PAIK SEUNG HWAN [KR]


Publication No.: WO2013101713A1  Published: 04/Jul/2013

Title: A NUTRITIONAL APPROACH TO THE USE OF ERGOTHIONEINE AND VITAMIN D2 FOR HAIR, NAIL AND SKIN GROWTH

Applicant/Assignee: ENTIA BIOSCIENCES, INC

Application No.: WO2012US71170 (PCT/US2012/71170)   Filing Date: 21/Dec/2012

Abstract:

Nutritional products, including food and/or beverage compositions, pharmaceutical and cosmetic preparations and methods of use are disclosed for the prevention, suppression and treatment of skin, hair, and nail conditions for the improvement of skin, hair and nail growth through the identification and/or use of stem cells, as well as maintenance of healthy tissues. Uses of Ergothioneine and/or Vitamin D to neutralize free radicals, and improve skin, hair and nail growth are disclosed.

Priority: US201161581480P Applic. Date: 2011-12-29

Inventor: HAUSMAN MARVIN S [US]


Publication No.: WO2013102234A1  Published: 11/Jul/2013

Title: FORMULATION AND METHOD FOR TREATMENT OF PAIN AND/OR INFLAMMATION ASSOCIATED WITH A SKIN CONDITION

Applicant/Assignee: UBS ULTIMATE RELIEF PTY LTD

Application No.: WO2012AU00008 (PCT/AU2012/00008)   Filing Date: 06/Jan/2012

Abstract:

Topical formulations comprising an effective amount of menthol in combination with an acidifier, wherein the topical formulation has a pH of about 1 to 3, and methods comprising administration of the same, and use of the topical formulations to treat pain and/or inflammation associated with a skin condition are described. For example, the topical formulation relieves pain, redness, swelling, reduces rash and/or itching relating to skin conditions, such as, but not limited to, any kind of envenomation from stings and/or bites from animals, insects and plants in addition to contact dermatitis, burns, urticaria, rash and other forms of dermatitis. Treatment of pain and/or inflammation including activation and/or stimulation and/or blocking and/or reducing the activity of one or more pain receptors to thereby treat the pain and/or inflammation is described.

Priority: WO2012AU00008 Applic. Date: 2012-01-06

Inventor: STEVENSON PETER [AU]; KNOWLES DARYLL [AU]; SMITH PETER [AU]


Publication No.: WO2013102728A1  Published: 11/Jul/2013

Title: POLAR EXTRACT OF KNIPHOFIA UVARIA, COSMETIC OR DERMATOLOGICAL COMPOSITION CONTAINING SAME, AND USES THEREOF

Applicant/Assignee: LVMH RECHERCHE

Application No.: WO2013FR50002 (PCT/FR2013/50002)   Filing Date: 02/Jan/2013

Abstract:

The invention relates to an extract of Kniphofia uvaria obtained by means of a cosmetically or dermatologically acceptable polar solvent, and also to a cosmetic or dermatological composition comprising this extract. The invention relates to the use of this extract in a cosmetic composition as an active agent, for combating intrinsic or actinic skin ageing, and for combating slackening of the skin. It also relates to the use thereof in a dermatological composition for combating inflammatory states of the skin.

Priority: FR20120050076 Applic. Date: 2012-01-04

Inventor: PECHER VIRGINIE [FR]; RENIMEL ISABELLE [FR]; LEPLANQUAIS VIRGINIE [FR]; LAZOU KRISTELL [FR]


Publication No.: WO2013103089A1  Published: 11/Jul/2013

Title: CULTURE METHOD FOR MAINTENANCE AND PROPAGATION OF STEM CELLS BY LYSOPHOSPHOLIPID SIGNAL CONTROL

Applicant/Assignee: TOHOKU UNIVERSITY

Application No.: WO2012JP82979 (PCT/JP2012/82979)   Filing Date: 19/Dec/2012

Abstract:

The problem addressed by the present invention is to provide a simple culture method for improving the number of times stem cells divide during ex vivo stem cell culture while maintaining the function of the stem cells. A method for culturing stem cells that comprises a step for culture of stem cells under conditions by which the function of the lysophosphatidic acid (LPA) receptor is inhibited is provided as a means for solving the problem.

Priority: JP20120001441 Applic. Date: 2012-01-06

Inventor: KIKUCHI TOSHIAKI [JP]; KANEHIRA MASAHIKO [JP]; NUKIWA TOSHIHIRO [JP]


Publication No.: WO2013103944A1  Published: 11/Jul/2013

Title: COMPOSITIONS AND METHODS FOR TREATING SKIN CONDITIONS

Applicant/Assignee: ALOE BABY, LLC

Application No.: WO2013US20488 (PCT/US2013/20488)   Filing Date: 07/Jan/2013

Abstract:

The present invention provides bio-active, nutritive gels. The gel composition can comprise a) at least about 50% concentrated Aloe vera gel by weight, as a percentage of total weight

b) at least about 1 % carrier oil by weight, as a percentage of total weight

and c) at least about 0.05% essential oil by weight, as a percentage of total weight. The gels may be massaged into the skin and allowed to dry prior to any application of a barrier cream/ointment/aerosol. Related compositions and methods are also provided herein.

Priority: US201261584234P Applic. Date: 2012-01-07

Inventor: MERCER-TACHICK MELISSA J [US]


Publication No.: WO2013104399A1  Published: 18/Jul/2013

Title: TOPICAL PHARMACEUTICAL COMPOSITIONS COMPRISING BEXAROTENE AND A CORTICOSTEROIDS

Applicant/Assignee: ALMIRALL, S.A

Application No.: WO2012EP05237 (PCT/EP2012/05237)   Filing Date: 18/Dec/2012

Abstract:

Topical pharmaceutical compositions are described comprising: a) bexarotene, b) a corticosteroid, and c) a carrier or vehicle. Said compositions are useful for the treatment of skin disorders.

Priority: EP20120000077 Applic. Date: 2012-01-09; US201261585786P Applic. Date: 2012-01-12; EP20120000909 Applic. Date: 2012-02-13; US201261598095P Applic. Date: 2012-02-13

Inventor: EVERS FRITJOF [DE]; FIELHAUER SABINE [DE]; MALLWITZ HENNING [DE]; TROMMER HAGEN [DE]; WILLERS CHRISTOPH [DE]


Publication No.: WO2013104575A1  Published: 18/Jul/2013

Title: THIENOPYRIMIDINE COMPOUNDS

Applicant/Assignee: F. HOFFMANN-LA ROCHE AG

Application No.: WO2013EP50139 (PCT/EP2013/50139)   Filing Date: 07/Jan/2013

Abstract:

The present invention relates to the use of novel compounds of Formula (I), wherein all variable substituents are defined as described herein, which are SYK inhibitors and are useful for the treatment of auto-immune and inflammatory diseases.

Priority: US201261584863P Applic. Date: 2012-01-10

Inventor: CHEN SHAOQING [US]; HERMANN JOHANNES CORNELIUS [US]; LE NAM T [US]; LUCAS MATTHEW C [US]; PADILLA FERNANDO [US]


Publication No.: WO2013104698A1  Published: 18/Jul/2013

Title: SCARRING REDUCING WOUND TREATMENT

Applicant/Assignee: SASTOMED GMBH

Application No.: WO2013EP50374 (PCT/EP2013/50374)   Filing Date: 10/Jan/2013

Abstract:

The present invention refers to the use of hemoglobin or myoglobin charged with a non-oxygen ligand for improved scarring of wounds.

Priority: EP20120000176 Applic. Date: 2012-01-13

Inventor: SANDER MICHAEL [DE]


Publication No.: WO2013105056A1  Published: 18/Jul/2013

Title: PYRROLIDINE- SUBSTITUTED FLAVONE DERIVATIVES FOR PREVENTION OR TREATMENT OF ORAL MUCOSITIS

Applicant/Assignee: PIRAMAL ENTERPRISES LIMITED

Application No.: WO2013IB50263 (PCT/IB2013/50263)   Filing Date: 11/Jan/2013

Abstract:

The present invention relates to the pyrrolidine substituted with flavone derivatives, represented by the compounds of Formula (I) (as described herein) or pharmaceutically acceptable salts, solvates, stereoisomers or diastereoisomers thereof or pharmaceutical compositions containing the compounds of Formula (I) for use in the prevention and/or treatment of oral mucositis caused by cancer therapy such as radiation therapy.

Priority: US201261586428P Applic. Date: 2012-01-13

Inventor: SHARMA SOMESH [US]; HATFIELD ALAN [IN]; ACHARYA SHIVANI [IN]


Publication No.: WO2013105417A1  Published: 18/Jul/2013

Title: BIOCHEMICAL EVALUATION METHOD

Applicant/Assignee: ADVANGEN, INC

Application No.: WO2012JP83250 (PCT/JP2012/83250)   Filing Date: 21/Dec/2012

Abstract:

The purpose of the present invention is: to provide a means whereby it is possible to quickly, efficiently and accurately evaluate a substance having an effect on the biochemical reaction of a cell growth factor

to provide a method for screening a substance having an effect on the biochemical reaction of a cell growth factor by applying the aforementioned means

and to put the substance found by means of the aforementioned screening method into effective use. This biochemical evaluation method is characterized in that the alkaline phosphatase (ALP) activity value and the cell growth degree of dermal papilla cells obtained by culturing dermal papilla cells (A) under specific conditions are measured, and the biochemical action of a substance to be evaluated with regard to the biochemical action of the dermal papilla cells (A) is evaluated in accordance with specific evaluation standards.

Priority: JP20120005220 Applic. Date: 2012-01-13

Inventor: YAMAUCHI KOICHI [JP]; YAMAMOTO MASAKUNI [JP]; MATSUMOTO TAKEO [JP]


Publication No.: WO2013105665A1  Published: 18/Jul/2013

Title: COLLAGEN STRUCTURE, AND METHOD FOR PRODUCING COLLAGEN STRUCTURE

Applicant/Assignee: NIPPI, INCORPORATED

Application No.: WO2013JP50484 (PCT/JP2013/50484)   Filing Date: 11/Jan/2013

Abstract:

A collagen structure characterized by comprising collagen fibers that have an average diameter of 1 to 5 mum, and having a water content of 0 to 15 (w/w)% and a collagen density of 50 to 800 mg/cm3. An acidic collagen solution is neutralized to produce collagen fibers, and then the solution is subjected to filtration or the like to produce crude collagen fibers having a collagen concentration of 12 to 50 (w/v)%. The crude collagen fibers are shaped into a predetermined shape, and the resultant product is dried, thereby producing the collagen structure. Since collagen fibers composed of associated collagen molecules is used as a material for the collagen structure, the collagen structure has excellent cell invasiveness. Further, since the collagen density in the collagen structure is equivalent to that in a collagen tissue in a living body, the collagen structure can exhibit excellent tissue regeneration performance when filled into a lost part in a living body, and therefore can be used suitably as an artificial material for regenerative medicine or the like.

Priority: JP20120003883 Applic. Date: 2012-01-12

Inventor: OGURA TAKAYUKI [JP]; TANAKA KEISUKE [JP]; OHBA YASUHIRO [JP]; HATTORI SHUNJI [JP]


Publication No.: WO2013105734A1  Published: 18/Jul/2013

Title: COMPOSITION FOR IMPROVING ACNE-PRONE SKIN

Applicant/Assignee: MR INNOVATION CO. LTD

Application No.: WO2012KR10408 (PCT/KR2012/10408)   Filing Date: 04/Dec/2012

Abstract:

A composition for improving acne-prone skin of the present invention contains a culture solution of Photorhabdus temperata subsp. temperat as an active ingredient. The present invention provides a composition for improving acne-prone skin which inhibits the growth of Propionibacterium acnes, an acne causing microorganism in the skin, by containing a culture solution of Photorhabdus temperata subsp. temperat, is safe for the skin, and has excellent moisturizing effects.

Priority: KR20120002844 Applic. Date: 2012-01-10

Inventor: KIM TAE WAN [KR]; KIM AE JUNG [KR]; NAM UK HO [KR]


Publication No.: WO2013106570A1  Published: 18/Jul/2013

Title: COMBINATION OF BETA-HYDROXY-BETA-METHYLBUTYRATE, ARGININE AND GLUTAMINE FOR USE IN TREATING DIABETIC ULCERS

Applicant/Assignee: ABBOTT LABORATORIES

Application No.: WO2013US21029 (PCT/US2013/21029)   Filing Date: 10/Jan/2013

Abstract:

Disclosed is the combination of beta-hydroxy-beta-methylbutryate, arginine, and glutamine for use in a method of treating a diabetic ulcer in a diabetic individual having at least one of: (a) a serum albumin level of less than or equal to 4.0 g/dL, and/or (b) an Ankle-Brachial Index of less than 1.0. 9. Also disclosed is the use of the combination of beta-hydroxy-beta-methylbutryate, arginine, and glutamine for the manufacture of a medicament for use in the treatment of a diabetic ulcer in a diabetic individual having at least one of: (a) a serum albumin level of less than or equal to 4.0 g/dL, and/or (b) an Ankle-Brachial Index of less than 1.0. In certain embodiments, the combination of beta-hydroxy-beta-methylbutyrate, arginine, and glutamine are orally administered via a nutritional composition.

Priority: US201261585265P Applic. Date: 2012-01-11

Inventor: NELSON JEFFREY L [US]; VOSS ANNE C [US]; BAGGS MARIA G [US]; PAULE CHARLES L [US]; HEGAZI REFAAT A [US]; SUAREZ FABRIZIS [US]; FANJIANG GARY [US]


Publication No.: WO2013106855A1  Published: 18/Jul/2013

Title: TREATMENT OF SKIN DISEASE

Applicant/Assignee:

Application No.: WO2013US21485 (PCT/US2013/21485)   Filing Date: 14/Jan/2013

Abstract:

The present invention is drawn to compositions, systems, and methods of treating skin disease. In one example, the composition includes a peroxygen, a transition metal or alloy thereof, and optionally, an alcohol and/or a drug. The composition can be packaged as part of a two-part system.

Priority: US201261586485P Applic. Date: 2012-01-13

Inventor: LARSON BRIAN G [US]; LARSON DAVID [US]


Publication No.: WO2013107206A1  Published: 25/Jul/2013

Title: CHINESE HERBAL MEDICINE COMPOSITION FOR TREATING DIABETIC FOOT

Applicant/Assignee:

Application No.: WO2012CN84295 (PCT/CN2012/84295)   Filing Date: 08/Nov/2012

Abstract:

A Chinese herbal medicine composition for treating diabetic foot, consisting of the following raw material medicines in parts by weight: 1-30 parts of scorpion, 1-30 parts of lithargite, 1-30 parts of centipede, 1-20 parts of borneol, 1-20 parts of cirsium japonicum, 1-20 parts of pangolin, 1-20 parts of castor beans, 1-20 parts of garden burnet, and 1-20 parts of safflower. The composition has the effects of clearing heat and detoxicating, eliminating necrotic tissue and promoting granulation, stimulating blood circulation and removing blood stasis, warming and activating arteries and veins, and reducing swelling and stopping pain, and is used to treat nerve patho-type, artery ischemia-type and mixed-type diabetic foot with the symptoms of foot muscular atrophy, deformity, skin infection, purulence, rhagades and ulcers, and toe tip ulcers and gangrene.

Priority: CN2012117351 Applic. Date: 2012-01-19

Inventor: SUN WANKUI [CN]


Publication No.: WO2013107236A1  Published: 25/Jul/2013

Title: CRYSTAL FORM OF (6S)-5-METHYLTETRAHYDROFOLATE SALT AND METHOD FOR PREPARING SAME

Applicant/Assignee: LIANYUNGANG JINKANG HEXIN PHARMACEUTICAL CO. LTD

Application No.: WO2012CN86794 (PCT/CN2012/86794)   Filing Date: 17/Dec/2012

Abstract:

Disclosed is a crystal form of (6S)-5- methyltetrahydrofolate salt and a method for preparing same. The crystal form is: C form of the crystal form of (6S)-5- methyltetrahydrofolate calcium salt, the X-ray diffraction pattern thereof having diffraction peaks at the 2theta angles of 6.3+-0.2 and 19.2+-0.2

or the crystal form of (6S)-5- methyltetrahydrofolate strontium salt, the X-ray diffraction pattern thereof having diffraction peaks at the 2theta angles of 6.5+-0.2 and 22.0+-0.2. The crystal form of (6S)-5- methyltetrahydrofolate salt in the present invention has advantages such as excellent physicochemical properties, good stability, high purity, good reproducibility, and being more suitable for production on an industrial scale.

Priority: CN2012119038 Applic. Date: 2012-01-20; CN20121125133 Applic. Date: 2012-04-25; CN2012118941 Applic. Date: 2012-01-20

Inventor: WANG ZHEQING [US]; CHENG YONGZHI [CN]; HUANG HENG [CN]; LI HUIZHEN [CN]


Publication No.: WO2013107333A1  Published: 25/Jul/2013

Title: PIPERAZINYL PYRIMIDINE DERIVATIVES, PREPARATION METHOD AND USE THEREOF

Applicant/Assignee: INSTITUTE OF PHARMACOLOGY AND TOXICOLOGY ACADEMY OF MILITARY MEDICAL SCIENCES P.L.A. CHINA, PEKING UNIVERSITY

Application No.: WO2013CN70469 (PCT/CN2013/70469)   Filing Date: 15/Jan/2013

Abstract:

Provided are piperazinyl pyrimidine derivatives of formula I having CCR4 antagonism, and the preparation method, pharmaceutical composition and use thereof in the preparation of a medicament. The medicament is useful for the treatment and prevention of CCR4-related diseases.

Priority: CN2012111263 Applic. Date: 2012-01-16

Inventor: LI SONG [CN]; WANG YING [CN]; XIAO JUNHAI [CN]; MA DALONG [CN]; GONG HONGWEI [CN]; QI HUI [CN]; WANG LILI [CN]; LING XIAOMEI [CN]; ZHENG ZHIBING [CN]; ZHANG YANG [CN]; ZHONG WU [CN]; LI MEINA [CN]; XIE YUNDE [CN]; XU ENQUAN [CN]; LI XINGZHOU [CN]; MA JING [CN]; ZHAO GUOMING [CN]; ZHOU XINBO [CN]; WANG XIAOKUI [CN]; LIU HONGYING [CN]


Publication No.: WO2013107609A1  Published: 25/Jul/2013

Title: SYSTEMIC ADMINISTRATION FORMS WITH CONTROLLED RELEASE AND IMPROVED STABILITY

Applicant/Assignee: MARIA CLEMENTINE MARTIN KLOSTERFRAU VERTRIEBSGESELLSCHAFT MBH

Application No.: WO2013EP00010 (PCT/EP2013/00010)   Filing Date: 04/Jan/2013

Abstract:

The invention relates to a monoterpene-containing administration form for peroral administration in the form of a capsule, especially in the form of a capsule with core-shell structure with multilayer shell, with improved storage stability, and with improve mechanical, optical and tactile properties.

Priority: DE20121000982 Applic. Date: 2012-01-20; DE20121001731 Applic. Date: 2012-01-31

Inventor: MIETHING HOLGER [DE]; GREVE HARALD [DE]


Publication No.: WO2013107809A1  Published: 25/Jul/2013

Title: USE OF AZOLE ANTIFUNGALS FOR THE TREATMENT OF ACTINIC KERATOSIS

Applicant/Assignee: MERZ PHARMA GMBH & CO. KGAA

Application No.: WO2013EP50819 (PCT/EP2013/50819)   Filing Date: 17/Jan/2013

Abstract:

Use of azole antifungals for the treatment of actinic keratosis.

Priority: EP20120151796 Applic. Date: 2012-01-19; US201261588201P Applic. Date: 2012-01-19

Inventor: POOTH RAINER [DE]; BARG HEIKO [DE]; ABTS HARRY FRANK [DE]; KIEHM KEVIN [DE]


Publication No.: WO2013107839A2  Published: 25/Jul/2013

Title: PHOSPHOLIPID COMPOUNDS FOR USE IN SKIN CANCER TREATMENT

Applicant/Assignee: TECHNISCHE UNIVERSITAET GRAZ, MEDIZINISCHE UNIVERSITAET GRAZ

Application No.: WO2013EP50888 (PCT/EP2013/50888)   Filing Date: 18/Jan/2013

Abstract:

The present invention relates to phospholipid compounds of formula I wherein R1 is selected from the group consisting of: -CO(CH2)pCHO and -CO(CH2)pCOOH, wherein p = 1-7, and R2 is selected from the group consisting of: -CO(CH2)nCH3 and -(CH2)mCH3, wherein n = 8-16 and m = 8-20, for use in the treatment of skin cancer and precancerous skin lesions.

Priority: EP20120151879 Applic. Date: 2012-01-20

Inventor: HERMETTER ALBIN [AT]; RAMPRECHT CLAUDIA [AT]; SCHAIDER HELMUT [AT]


Publication No.: WO2013108771A1  Published: 25/Jul/2013

Title: METHOD FOR EXTRACTING LYSYL OXIDASE FROM EGGSHELL MEMBRANE

Applicant/Assignee: AMANO ENZYME INC

Application No.: WO2013JP50628 (PCT/JP2013/50628)   Filing Date: 16/Jan/2013

Abstract:

The purpose of the present invention is to provide a method for extracting lysyl oxidase, which is a useful component in eggshell membrane, at a high yield. A protease is caused to act on eggshell membrane, and the soluble lysyl oxidase is extracted and recovered.

Priority: JP20120007499 Applic. Date: 2012-01-17

Inventor: KOYAMA TAKAHUMI [JP]; TANAKA SHUN-ICHI [JP]


Publication No.: WO2013108837A1  Published: 25/Jul/2013

Title: PYRAZOLE DERIVATIVE WITH TLR INHIBITING PROPERTIES

Applicant/Assignee: KOWA COMPANY, LTD

Application No.: WO2013JP50805 (PCT/JP2013/50805)   Filing Date: 17/Jan/2013

Abstract:

The objective of the present invention is to provide a novel compound that inhibits at least one type selected from the group consisting of TLR3, TLR7 and TLR9, and that has excellent preventive and therapeutic effects on autoimmune diseases, inflammations, allergies, etc. A compound represented by general formula (1) or a salt thereof, or a solvate thereof. [In the formula: rings W and Z are 5 to 7 membered saturated or partially unsaturated nitrogen-containing heterocyclic groups

T is a C1-6 alkyl group which may be substituted with an oxo group

ring Y is a group represented by formulas (2), (3) or (4)

(2) (3) (4) X1, X2 and X3 are C-R7 or nitrogen atoms, wherein X1 and X2 are not simultaneously C-R7

R7 is a hydrogen atom, a halogen atom, a hydroxyl group, etc.

S and U are single bonds or N-R8

R8 is a hydrogen atom or a C1-6 alkyl group

V is a hydrogen atom, a C1-6 alkyl group, a C6-10 aryl C1-3 alkyl group, a 3 to 7 membered saturated heterocyclic group, etc.]

Priority: JP20120008074 Applic. Date: 2012-01-18; JP20120178453 Applic. Date: 2012-08-10

Inventor: TAKEMURA SHUNJI [JP]; NISHIYAMA TATSUAKI [JP]; TABUNOKI YUICHIRO [JP]; YAMABI MASAKI [JP]; MIYAKE YOSHIHARU [JP]


Publication No.: WO2013108857A1  Published: 25/Jul/2013

Title: HETEROCYCLIC AMIDE DERIVATIVE AND PHARMACEUTICAL PRODUCT CONTAINING SAME

Applicant/Assignee: AJINOMOTO CO., INC

Application No.: WO2013JP50854 (PCT/JP2013/50854)   Filing Date: 17/Jan/2013

Abstract:

A purpose of the present invention is to provide a novel compound which has TRPA1 antagonist activity and a pharmaceutical product which contains the compound. Another purpose of the present invention is to provide a TRPA1 antagonist and a medical agent which is useful for prophylaxis or treatment of diseases associated with TRPA1. A pharmaceutical product or the like which contains a compound represented by formula (I) or a pharmaceutically acceptable salt thereof. (In formula (I), the symbols are as defined in the description.)

Priority: JP20120007536 Applic. Date: 2012-01-17

Inventor: SUZUKI TAMOTSU [JP]; KOBAYASHI KAORI [JP]; ASARI SAYAKA [JP]; SHIRAISHI SEIJI [JP]; OKUZUMI TATSUYA [JP]


Publication No.: WO2013109323A2  Published: 25/Jul/2013

Title: TOPICAL DTPA PRODRUG FORMULATIONS AND METHODS OF USING THE SAME

Applicant/Assignee: THE UNIVERSITY OF NORTH CAROLINA AT CHAPEL HILL

Application No.: WO2012US60985 (PCT/US2012/60985)   Filing Date: 19/Oct/2012

Abstract:

The present invention relates to topical trisodium diethylenetriamine pentaacetic acid (DTPA) prodrug formulations and methods of using the same.

Priority: US201161549801P Applic. Date: 2011-10-21

Inventor: JAY MICHAEL [US]; MUMPER RUSSELL [US]; ZHANG YONG [US]


Publication No.: WO2013110050A1  Published: 25/Jul/2013

Title: INULIN AND INULIN ACETATE FORMULATIONS

Applicant/Assignee: SOUTH DAKOTA STATE UNIVERSITY

Application No.: WO2013US22463 (PCT/US2013/22463)   Filing Date: 22/Jan/2013

Abstract:

The disclosure provides compositions that include microparticles or nanoparticles of beta inulin or inulin acetate and an active agent, where the active agent is contained within individual microparticles or nanoparticles. The active agent can be, for example, a vaccinating antigen, an antigenic peptide sequence, or an immunoglobulin. The compositions can be incorporated into various formulations for administration to a subject such as a human or animal. The invention further provides methods of using the compositions and formulations, including methods of stimulating an immune response in a subject, or enhancing an immune response in a subject, for the purposes of treating, preventing, or inhibiting an infectious disease, autoimmune disease, immunodeficiency disorder, neoplastic disease, degenerative disease, an aging disease, or a combination thereof.

Priority: US201261589126P Applic. Date: 2012-01-20

Inventor: TUMMALA HEMACHAND [US]; KUMAR SUNNY [US]


Publication No.: WO2013110077A1  Published: 25/Jul/2013

Title: TOPICAL THERAPEUTIC FORMULATIONS

Applicant/Assignee: HYBRID MEDICAL, LLC

Application No.: WO2013US22568 (PCT/US2013/22568)   Filing Date: 22/Jan/2013

Abstract:

The invention provides topical compositions and methods for using the compositions. The compositions can be used for the treatment of fibrotic or connective tissue disorders involving scarring, sub-dermal plaque accumulations, or fibrosis of muscle tissue. The disorders can be painlessly treated by the topical application of a composition described herein. One or more calcium channel blocker agents can serve as an active ingredient of the compositions, optionally in combination with, for example, one or more of emu oil and superoxide dismutase. The composition can further include pharmaceutically acceptable carriers that can facilitate the non-invasive transdermal delivery of the active(s) to subdermal sites.

Priority: US201261588441P Applic. Date: 2012-01-19

Inventor: TWIDWELL JEFF [US]; BUCKLEY JOEL [US]; HOIUM HAROLD [US]


Publication No.: WO2013110756A1  Published: 01/Aug/2013

Title: INGENOL MEBUTATE IN COMBINATION WITH CRYOTHERAPY FOR THE TREATMENT OF ACTINIC KERATOSIS

Applicant/Assignee: LEO PHARMA A/S

Application No.: WO2013EP51435 (PCT/EP2013/51435)   Filing Date: 25/Jan/2013

Abstract:

The invention relates to the treatment of actinic keratosis (AK) lesions using sequential cryotherapy and field treatment with ingenol mebutate (e.g., PEP005 Gel).

Priority: US201261591093P Applic. Date: 2012-01-26; US201361753779P Applic. Date: 2013-01-17

Inventor: SKOV TORSTEN [DK]


Publication No.: WO2013111393A1  Published: 01/Aug/2013

Title: HAIR GROWING AGENT

Applicant/Assignee: TOKAI UNIVERSITY EDUCATIONAL SYSTEM

Application No.: WO2012JP75782 (PCT/JP2012/75782)   Filing Date: 04/Oct/2012

Abstract:

The present invention provides: a substance which has a higher hair growing effect than ever before

and a hair growing agent into which the substance is blended. A hair growing agent of the present invention is characterized by containing, as an active ingredient, an optically pure compound represented by formula (I-SR) or a pharmaceutically acceptable salt thereof. In formula (I-SR), R represents -C=CH, and each of R1, R2 and R3 independently represents a hydrogen atom, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom or an alkyl group having 1-4 carbon atoms.

Priority: JP20120012930 Applic. Date: 2012-01-25

Inventor: OZAWA AKIRA [JP]; FUJII SEISHIRO [JP]; KEZUKA SATOKO [JP]; KAWASHIMA KAZUKI [JP]


Publication No.: WO2013111729A1  Published: 01/Aug/2013

Title: PHARMACEUTICAL COMPOSITION AND QUASI-DRUG COSMETIC USING SAME

Applicant/Assignee: CAC CORPORATION

Application No.: WO2013JP51159 (PCT/JP2013/51159)   Filing Date: 22/Jan/2013

Abstract:

The invention provides a pharmaceutical composition comprising glucose as a tissue repair promoter. The invention further provides a quasi-drug cosmetic comprising the pharmaceutical composition.

Priority: JP20120011342 Applic. Date: 2012-01-23

Inventor: YAMADA HAJIME [JP]; YAMADA AKIRA [JP]; YAMADA JIRO [JP]; YAMADA KIYOKO [JP]; MATSUSHITA KENJI [JP]


Publication No.: WO2013111817A1  Published: 01/Aug/2013

Title: OIL-IN-WATER-TYPE CREAMY COMPOSITION CONTAINING TACROLIMUS

Applicant/Assignee: MARUHO CO., LTD

Application No.: WO2013JP51453 (PCT/JP2013/51453)   Filing Date: 24/Jan/2013

Abstract:

The purpose of the present invention is to provide a tacrolimus-containing pharmaceutical composition which is a creamy preparation for external application having a good sensation upon use and has high main ingredient stability (a high main ingredient residual ratio). The composition according to the present invention is an oil-in-water-type creamy composition characterized by comprising (A) tacrolimus, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable solvate thereof, (B) diethyl sebacate and/or diisopropyl sebacate, (C) polyoxyethylene hydrogenated castor oil, (D) a hydrophilic polymer and (E) an anti-oxidative agent.

Priority: JP20120012953 Applic. Date: 2012-01-25

Inventor: IHARA MIKITO [JP]; UEDA YOSHINORI [JP]; NARUMI FUMINORI [JP]


Publication No.: WO2013112416A1  Published: 01/Aug/2013

Title: CLEAR SOLID STICKS WITH SOLUBILIZED PHARMACEUTICAL AGENTS

Applicant/Assignee: PRODUCT AND TECHNOLOGY PARTNERS LLC

Application No.: WO2013US22435 (PCT/US2013/22435)   Filing Date: 22/Jan/2013

Abstract:

The invention discloses a solid transparent vehicle utilizing DBS in which a topical pharmaceutical active or cosmetic active is solubilized without the use of a monohydric and/or polyhydric alcohol thus providing a non-tacky, clear solid, which prevents segregation and insures uniformity in dosing.

Priority: US201213359451 Applic. Date: 2012-01-26

Inventor: MACKLES LEONARD [US]; BESS WILLIAM [US]


Publication No.: WO2013113024A1  Published: 01/Aug/2013

Title: LYOPHILIZED PLATELET LYSATES

Applicant/Assignee: JADI CELL LLC

Application No.: WO2013US23490 (PCT/US2013/23490)   Filing Date: 28/Jan/2013

Abstract:

The present disclosure is drawn to compositions and methods of making and using lyophilized platelet lysates. Specifically, a method of preparing a composition suitable for therapeutic use or as a culture medium can comprise steps of concentrating platelets from a platelet source to form a platelet rich portion of the platelet source, and lysing the platelets in the platelet rich portion to form a plurality of lysates. An additional step includes lyophilizing the lysates to form lyophilized platelet lysates in a composition with released concentrations of available growth factors, cytokines, and chemokines. In one example, at 30%, by platelet count, of platelets from a platelet source can be lysed using this process.

Priority: US201213358797 Applic. Date: 2012-01-26

Inventor: PATEL AMIT [US]

Clck to enlarge and view details
  PAGE 1
World  Patents Published  in 2012 - Page 2
...or use our Search Engine to
search for patent documents by
number.
Search for anything. Simply
type the words in the box..